Latest optiray inj Tenders | Government optiray inj Tenders

CTN :39853630

07 Apr, 2025 NA

Kannur - Kerala

Tender For purchase of lab,blood bank reagents and other consumables at district hospital kannur - purchase of lab,bloodbank reagents & other consumables for 2025-2026, ammonium sulphate (500 gm), barium cloride 10% (500 ml), benedicts reagent (500 ml), blood lancet, brush for microscope, brush small, clot activator tube (5ml), dengue 1gg/1gm card test, dengue ns1ag card test, disposable esr pipette, whatman filter paper,circle, fouchets reagent (125 ml), geimsa stain (500 ml), glucose +ketone bodies urine strip, glucose + protein urine strip, hbsag card test, hcg (upt) card test, hcv card test, heam test (occutt blood), heparin tube, hitachi cup, k3 edta tube (5ml), labo clean (5ml), leishman stain (500 ml), leptospira card test, liquid paraffin (500 ml), liquor ammonia (500 ml), microscopic cover slip, micro pipett fixed volume, micro pipett variable volume, micro slides, ph paper, sodium citrate esr tube, sodium citrate bottle3.8% (2 ml), sodium flouride coated bottle, sodium nitroprusside (100 gm), syringe 1 ml, test tube -glass (12 x 100mm), bullet vial - plastic, urine centrifuge tube- glass, urine sample container, urine sample container (sets sterile), vdrl (syphillis) card test, white tip (small) -5-20 micro ltr, yellow tip - 20-200 micro ltr, blue tip, widal slide test kit, round plaster, matrix gel card- 144t, liss solution ( 25 x 250ml), micro tips,1.5 ml, rpr card, anti d, blend (10 ml), anti d, igm (10 ml), anti a (10 ml), anti a1, lectin (10 ml), anti b,10 ml, anti d,igg 10 ml, anti h lectin, malaria card, hiv elisa test kit-96t, hbsag elisa kit (j .mithra)- 96t, hcv elisa kit (tulip)-96t- 96t, filter paper sheets, skin stapler (steel), disposable surgery kit, bd spiral needle no.25, bd spiral needle no.27, disposable syringe with needle 5ml, disposable syringe with needle 2 ml, et tube no.7, et tube no.7.5, dyna plast, ecg electrodes, top o plast (1mtr), ringer lactate ivf (500 ml) glass bottle, ecg paper- bpl 9108 d-z fold -210 x 140 x 140-12 channel (original with 80gsm), ecg paper- bpl 9108 -z fold a4 -12 channel(original with 80gsm), ecg paper- bpl 6108t-single channel (original with 80gsm), ecg paper- bpl 6208 view -80 x 20 mtr- 3 channel(original- 80gsm), ecg paper rolled 210- 12 channel, ctg paper, tmt paper(schiller), ecg gel- 250 ml, bpl limb electrodes clip (04 nos/box), bpl chest electrodes (06 nos/box), swab stick (sterile tube), ortho- phthalaldehyde solution -5ltr can, tourniquet, liquid detergent, rpr test kit, plastic test tubes(riya tubes)(100 nos pkt), sulphosalycylic acid-500 ml btl, sulpher powder-pkt, isopropyl alcohol-500 ml btl, aso test kit, whatman no.1 filter paper, x ray ( computerised radio graphy- model a), fuji film (18 cm x 24 cm) or ( 8" x 10"), fuji image plate (18 cm x 24 cm) or ( 8" x 10"), fuji cassette (18 cm x 24 cm) or ( 8" x 10")

CTN :39858886

18 Apr, 2025 10.65 Lacs

Ferozepur - Punjab

Tender For supply of acebrophyllin 100mg acetycstine 600mg pulmoclear tab , acetaminophen 325 mg plus tramadol 37.5 mg ultracet tab , alovera and vitamin e lotion , alprazolam 0.5 mg tab , amitriptyline 10 mg tab , aripiprazole 5 mg tab , aspirin 75 mg plus atorvastatin 10 mg plus clopidogril 75 mg tab , aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , asthalin respules levolin resp , azelasartan 40 mg tab , baclofen 20 mg tab , betahistine 24 mg tab , brivaracetam 100mg tab , calcium vit d3 syp 200ml bott , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , capesitabine 400mg plus cyclophosphamide 20mg tab , carbamazepine 200 mg cr tab , cefuroxime 500mg plus clavuclonic acid 125 mg tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg , chlorhexidine mouthwash 2 perc bottle of 150 ml , cilinidium plus chlordiazepoxide plus dicyclomine tab , cinitapride 3mg plus pantoprazole 40mg tab , clarithromycin 250mg tab , clobetasol plus gentamicin oint , clonazepam 2 mg tab , clopidogrel 75 mg plus aspirin 75 mg tab , clozapine 100 mg tab , coenzyme q10 100 mg tab , coenzyme q300 mg tab , collagen peptide plus hyaluronate tab , combipack of amoxicillin 750mg plus tinidazole 500 mg plus omeprazole 20 mg hp kit , daflon 500mg diosmin 450mg plus hesperidin 50mg tab , dapagliflozin 10 mg plus metformin 500 mg tab , dienogest 2mg tab , disodium hydrogen citrate syrup , donepezil 5mg plus memantine 10mg tab , drotaverine hcl 40 mg tab , ed bimatoprost 0.01 perc , ed nepafenac 0.1perc w v , ed olopatadine plus ketorolac bott of 10ml , ed potassium iodide sodium chloride and calcium chloride calodin 5 ml , ed travaprost plus timolol bott of 10ml , enteral feed powder protein 85 perc short chain peptides 15perc free amino acids fat 50 perc mct 25 perc vet fat carbohydrate malto destri sht of 126gm , eperisone 50 mg tab , escitalopram 5 mg plus clonazepam 0.5 mg , escitalopram 5 mg plus clonazepam 0.5 mg tab , evening primarose 1000 cap , fenofibrate 200mg plus atorvastatin 10mg tab , flupentixol 0.5 mg plus melitracen 10 mg tab , flurbiprofen 0.03 perc eye drop , fungal diastace plus papaine plus activated charcol unienzyme , ginkgo biloba tab , glimepiride 2mg metformin 500mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glucose powder , heparin 15g 20g oint , human insulin analogue aspart premix 30 per insulin 70 per insulin protamine aspart suspension 100 iu ml 3 ml pfs , hydrochlorothiazide 12.5 mg tab , indapamide 1.5mg tab , inh beclomethason 200mcg 200 meter dose inh , inh salmeterol 25mcg plus fluticasone 125mcg 120 mdi , inh triohale tiotropium bromide 9 mcg plus formoterol 6 mg plus ciclesonide 200mcg 200 meter dose inh , inj degludec insulin aspart ryzodeg , inj filgrastim 300 mcg , inj human mixtard 30-70 , inj insulin liraglutide 6mg ml 18mg pen , insulin humalog lispro inj recombinan dna origin 100iu mlcartidge , isosorbid 5 mg monontrate 30 mg tab , isosorbid mononitrate 10 mg tab , isosorbide dinitrate 5 mg tab , ketoconazole shampoo , ketoralac 0.2 perc e d , l carnitine 500mg tab , levocarnitine 500 mg tab , lignocain plus gabapentin oint , linagliptin 5 mg plus empagliflozin 10 mg tab , liq paraffin 100 ml bott , losartan 50mg plus hydrochlorthiazide 12.5mg tab , memantine 5 mg plus donepezil 5 mg tab , mesalamine 400 gm tab , metolazone 2.5 mg tab , metoprolol xl 12.5 mg tab , midodrine 10mg tab , minoxidil 5 perc w v lotion 60 ml , mirabegron 25mg plus solifenacin 5mg tab , mirtazapine 7.5 mg tab , montelukast plus bid details/ 2 / 152 levocetrizine plus acebrophylline 200mg tab , multivitamin plus multimineral tab , multivitamin syp , nandrolone deconate 50 mg inj , nasal spray calcitonin 200iu , nepafenac 0.3 perc w v5 ml ed , nifedipine retard 10 mg tab , nitroglycerin 2.6 mgtab , omega 3 fatty acid cap , omega fatty acid plus antioxidant cap , powder clotrimazole 75 gm , propranol 40 mg tab , rabeprazole 20 mg plus levosulpride 75mg tab , rabeprazole

CTN :39842632

22 Apr, 2025 14.11 Crore

Chandrapur - Maharashtra

Tender For tender for supply of medicines (allopathic) and surgical items - name of durgs/medicine & surgical, dinoprostone gel, cap.hydroxyurea 500 mg, cap.itraconazole 100 mg, chloramphenicol polymyxin b ulphateopthaloint 5gm (occupol), drop xylometazoline 0.01% w/v nasal drop 5 ml. vial, eye drop carboxymethyl cellulose sodium 0.5% w/v, eye drop ciprofloxacin 0.3 % w/v 5 ml. vial, eye drop moxifloxacin + prednisolone, i.v. human normal albumin 20% 100 ml., i.v. levofloxacin 500 ml., i.v.sodium chloride 0.9% w/v ns 500 ml., i.v. ringer lactate 500 ml. (plastic bottle), inj. anti rabies serum (ars) - 1500 iu, inj.clindamycin 600mg/vial, ing.cefotaxime 1gm vial, ing.ceftriaxone 1gm vial, inj. enoxaparin 0.6 mg/ml (l.m.w.h.), inj. epidosine 2 ml. (valethemate bromide), inj. erythropoietine 10000 iu., inj. hepatitis b immunoglobulin 100 iu, inj. hepatitis-b vaccine (r-dna) 5 ml., ing.hyosine butyl bromide (buscopan) 20mg/ml, inj. levetiracetam 100/500 mg, ing.lignocaine 2% 30ml vial, inj. lorazepam 2 mg/2 ml. amp, inj. meropenem 1 gm./vial, inj. methyl prednisolone 40 mg, inj. octreotide acetate 100 mcg, inj. ondensetron 2 mg/ml. amp. i.v., inj. pantoprazole 40 mg./vial, inj. piperacillin + tazobactum 4.5 gm., inj.human normal immunoglobulin-g 5gr, oint. clobetasole cream 0.05%w/v 30gr, oint.mupirocin 2% w/w, oint.povidone iodine 10% 15gm., oint. soframycin 30 gm. (framycetin sulphate 1%), syp. amoxycillin 200 mg + clavulanic acid 28.5 mg. 30 ml., syp.cetrizine 5mg/5ml 30ml, syp.levolin 1mg/5ml 100ml, syp.paracetamol 250mg/5ml 60ml, tab dicyclomine hcl 10 mg, tab thiocolchicoside 4mg, tab. amlodipine 5 mg., tab. amoxycillin + clavulanic acid. 625 mg., tab. deferasirox 500mg, tab. diazepam 5 mg., tab. escitalopram 10 mg., tab. fluconazole 150 mg., tab. ondansetron 4 mg., tab. sitagliptin 100 mg., tab.telmisartan 40mg, tab. thiamine, tab. thyroxine sodium 25 mcg., tab. thyroxine sodium 50 mcg., tab. tramadol 50 mg., tab. trypsin + chemotrypsin, tab. vitamin b-complex, tab.nifedipine 20mg, topical momentasone 0.1%, topical permethrin 5% lotion, inhaler seroflo 250mcg (salmeterol + fluticasole), oral rehydration salt (who formula), cerveprime gel (dinoproston gel), cap.hydroxyurea 500mg, chloramphenicol polymyxin b sulphateopthal oint 5gm (occupol), inhaler seroflo 250mcg (salmeterol+ fluticasone), cap.itraconazole 100 mg, tab thiocolchicoside 4mg, eye drop hypersol, drop xylometazoline 0.01% w/v nasal drop 5 ml. vial, eye drop carboxymethyl cellulose sodium 0.5% w/v, eye drop ciprofloxacin 0.3 % w/v 5 ml. vial, eye drop moxifloxacin + prednisolone, i.v. human normal albumin 20% 100 ml., i.v. isolyte-m 500 ml., i.v. levofloxacin 500 ml., i.v. linizolide 200 ml., i.v. metronidazole 5 mg/ml. 100 ml., i.v. ringer lactate 500 ml. (plastic bottle), i.v. sodium chloride 0.9% w/v 500ml. (iv n.s.), i.v. sodium chloride 0.9%+dextrose 5% (iv dns 500 ml.), i.v.sodium chloride 0.9% w/v 100 ml.(iv n.s.), inj. dicyclomine 1 mg/2 ml. amp, inj. adrenaline 1:1000 1 ml., inj. anti d (rho d human immunoglobulin monoclonal 300 mcg.), inj. anti rabies serum (ars) - 1500 iu, inj. b-complex 2 ml. amp., inj. carboprost tromethamine 250 mcg/ml. - 1 ml., inj. cefotaxime sodium 1gm. vial, inj. ceftriaxone 1 gm. vial, inj. clindamycin 600 mg/vial, inj. colistimethate sodium 1 million i.u. (inj. colistin), inj. cyanocobalmin (b12) 1000 mcg, inj. deriphylline 2 ml. amp, inj. dexamethasone sodium phosphate 4 mg/ml. amp., inj. dopamin 200 mg/10 ml., inj. drotaverin 20 mg. 2 ml, inj. enoxaparin 0.6 mg/ml (l.m.w.h.), inj. epidosine 2 ml. (valethemate bromide), inj. erythropoietine 10000 iu., inj. frusemide 40 mg. 2 ml, inj. heparin sodium 5000 iu/ml., inj. hepatitis b immunoglobulin 100 iu, inj. hepatitis-b vaccine (r-dna) 5 ml., inj.human normal immunoglobulin-g 5gr, inj. hyosine butyl bromide (buscopan) 20 mg/ml., inj. insulin human mixtard 30/70, inj. ketamine hydrochloride 50 mg/ml. 10 ml. vial, inj. levetiracetam 100/500 mg, inj. lignocaine 2% 30 ml. vial, inj. mening

Central Government/Public Sector

CTN :39649859

22 Apr, 2025 32.61 Crore

Ahmedabad - Gujarat

Tender For corrigendum : e-tenders are invited from the manufacturers for the two year rate contract cum supply of haemodialysis disposables and consumables items, crrt and peritoneal dialysis relateditems for institute of kidney disease and research centre (ikdrc), ahmedabad. - paediatric dialyzer (low/middle flux) 0.5m to 0.7m, dialyzer (low/middle flux) 1.0m to 1.1m, dialyzer (low/middle flux) 1.3m to 1.4m, dialyzer (low/middle flux) 1.7m to 1.8m, dialyzer (high flux) 1.7m to 1.8m, av bloodline set post pump-hd machine (adult), av bloodline set post pump-hd machine (paediatric), avf needle (16g/17g), acid concentration part a, acid concentration part a (with dextrose), acid concentration part a (k+ free), dry bicarbonate concentrate powder cartridge (650gm)for fresenius hd machine, dry bicarbonate concentrate powder cartridge (650gm) for nipro hd machine, hot disinfectant for h.d / hdf machine / water treatment system, cold disinfectant for h.d / hdf machine / water treatment system, disposable syringe 20ml sterilized w/o needle (virgin material), disposable syringe 10 ml sterilized w/o needle (virgin material), infusion set (iv set) with needle, latex medical examination gloves (non-sterile)(extra small/small/medium/large/extra large), r-hu erythropoietin 2000 iu injection pfs, r-hu erythropoietin 4000 iu injection pfs, r-hu erythropoietin 10000 iu injection pfs, heparin sodium 25000 iu / 5 ml injection, heparin sodium 5000 iu / 5 ml injection, multivitamin injection (2 ml to 5 ml), levocarnitine 1 gm/5 ml injection, sodium chloride 0.9percent w/v i.p. 1000 ml injection, sodium chloride 0.9percent w/v i.p. 500 ml injection, sodium chloride 0.9percent w/v i.p. 100 ml injection, dextrose 25percent w/v i.p.100 ml injection, haemodialysis on-off kit for dialysis procedure convenience, paper surgical adhesive tape roll (width-1 inch), transparent film dressing - 10cm x 12cm, transparent film with chg gel dressing - 8cm x 12cm (adult), transparent film with chg dressing - 7cm x 8.5cm (paediatric), double lumen dialysis catheter 11.5-12 fr. x 13-13.5 cm curved extension, double lumen dialysis catheter 11.5-12 fr. x 13-13.5 cm straight extension, double lumen dialysis catheter 11.5-12 fr. x 15-16 cm curved extension, double lumen dialysis catheter 11.5-12 fr. x 15-16 cm straight extension, double lumen dialysis catheter 11.5-12 fr. x 19-20 cm straight extension, double lumen dialysis catheter 10 fr. x 10 cm straight/curved extension, double lumen dialysis catheter 8-8.5 fr. x 9-12 cm straight/curved extension, double lumen dialysis catheter 6.5 fr. x 8 cm straight/curved extension

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39835249

16 Apr, 2025 25.73 Lacs

North 24 Paragana - West Bengal

Tender For procurement of generic medicines - cream.permathrin 5 percent 30gm , drop.ciprofloxacin 0.3 percent eye 5ml , drop.xylometazoline 0.1 percent nasal decongestant adult 10ml , inj.dexamethasone 4mg per ml 2ml , inj.diazepam 10mg per 2ml , inj.dicyclomine 10mg per ml 2ml , inj.metoclopramide 5mg per ml 2ml , inj.ondansetron 2mg per ml 2ml , inj.pantoprazole 40mg , inj.pheniramine maleate 22.75mg , lignocaine hcl gelly 2 percent 30gm , lotion.povidone iodine 10 percent 500ml , mdi levosalbutamol 50mcg per dose , sterile water for injection 10ml , syr.albendazole 10ml , amoxycillin 200mg clavulanic acid 28.5mg and lactic acid bacillus 60 million spore dry syrup , syr.cefixime 50mg per 5ml bott of 30ml , tab.clobazam 5mg , tab.clopidogrel75mg , tab.enalapril 5mg , tab.escitalopram 10mg , tab.folic acid 5mg , tab.isosorbide 5 mononitrate 20mg , tab.levothyroxin 25mcg , tab.levothyroxine 100mcg , tab.levothyroxine 50mcg , tab.metformine 500mg sr , tab.metformin sr 1gm , tab.metoprolol 50 mg xl , tab.ondansetron 8mg , tab.prednisolone 5mg , tab.ramipril 5mg , tab.telmisartan 40mg , tab.telmisartan40 plus hydrochlorthz 12.5 mg , cap.tamsulosin 0.4mg , cap.vitamin e 400mg , ferrous ascorbate 100mg and folic acid 1.5mg tablets , clotrimazole1 percent powder 100gm , cream.silver sulphadiazine1 percent weight per weight 20gm , drop.ciprofloxacine plus dexamethasone 10 ml , drop.multivitamin bottle of 15ml , drop.sodium chloride nasal , inj.amikacin 250mg , inj.etophyllin 84.7mg plus theophylline 25.3mg per ml , inj.hydrocortisone sodium succ.100mg , inj.lignacaine 2 percent , inj.lignacaine 2 percent plus adrenalline , inj.tranexamic acid 500mg per 5ml , mdi ipratropium bromide plus levosalbutamol , oint.betamethasone 0.05 percent plus salicilic acid 3 percent 25gm , oint.mometasone 0.1 percent 10gm , oint.mupirocin 2 percent 5gm tube , heparin sodium 50iu and benzyl nicotinate 2mg ointment 20gm , levo-salbutamol 1.25mcg plus ipratropium 500mcg respules 2.5 ml , ambroxol hydrochloride 15 mg guaifenesin 50 mg and levosalbutamol sulphate 1 mg syrup , phenylephrine 5 mg chlorpheniramine 2 mg and dextromethorphan 10 mg syp , tab.aciclovir 800mg , tab.alprazolam 0.25mg , tab.aspirin enteric coated 150mg , tab.aspirin enteric coated 75mg , tab.betahistine hcl16mg , tab.cinnarizine 25mg , tab.etophylline-115 plus theophylline-35mg in slow release , tab.febuxostate 40mg , tab.fenofibrate 200mg , tab.finasteride 5mg , tab.glucosamin 500mg , tab.nor-ethisteron 5mg , tab.torsemide 10g , tab.voglibose 0.2mg , tab.voglibose 0.3mg , tab per cap.pregabolin 75mg , tab per cap.vitamin b complex b1 b6 b12 , antiseptic mouth wash chlorhexidineip 0.2 percent weight per volume 100ml , vit. d3 sachet cholecalciferol 60k , tab.teneligliptin 20mg , clotrimazole mouth paint 1 percent weight per volume 25ml , syp.ondansetron 2mg per 5ml 30ml , tab.montelukast10 plus levocetrizine , glyceryl trinitrate cr 2.6mg , mouth ulcer gel choline salicylate sodium 9 percent weight per volume benzalkonium chloride 0.01 percent weight per weight 10gm , drotaverine hcl tablets 40mg , atropine sulphate injection ip 0.6mg per ml 1ml , gabapentin capsules ip 300mg , carvedilol tablets ip 3.125 mg , tabsosorbide dinitrate ip 10mg , dopamine hydrochloride injection ip 200 mg per 5ml , streptokinase inj. ip 15 00 000 iu 10ml , carboxymethlycellulose eye drop 1 percent weight per volume 10ml , tranexamic acid tablets ip 500 mg , propranolol tablets ip 40 mg , lactulose solution 10g per 15ml 100ml , tab pregabalin sr75mg plus methylcobalamin 750mcg , sitagliptin phosphate tab. ip 100mg , dapagliflozin tablets 10 mg , inj.enoxaparin ip 40 mg per 0.4 ml , inj. enoxaparinip 60 mg per 0.6 ml , adenosine injection 3mg per ml 2 ml , phenytoin tablets ip 100 mg , metoprolol succinate pr 25mg tablets ip 25mg , rabeprazole gastro resistant tablets ip 20 mg , esomeprazole tablets ip 40mg , miconazole nitrate cream ip 2 percent , luliconazole cream ip 1 percent weight per weight 10gm , inj.tramadol

CTN :39446509

29 Mar, 2025 NA

Patiala - Punjab

Tender For corrigendum : supply of isoflurane bott of 100 ml , inj promethazine hcl 2.5 percent, 25mgm ml 2ml inj , tab clonazepam 2 mg , inj phenobarbitone sodium 200 mg in ampoule of 1ml , sumatriptan nasal spray 20 mg, 10 metered doses , nimodipine tab 30 mg , budesonide 1 mg repsules , salmetrol 25 mcg fluticasone 250mcg autohaler , new cdl rifampicin 600 mg plus tab inh 300 mg , fluticasone 0.05 percentw w cream 10 gm tube , fluocinolone acetonide 0.01percent hydroquinone 2percent plustretinoin 0.025percent tube of 20gm , enema sodium phosphate ml 6percent sod acid phosphate 16percent pack of 100ml , tab hydrocortisone- 20 mg , purified fsh 75 iu inj , heparin 10 unit ml 10 ml inj cath flush inj , 5-amino salicylic acid enema-4g

CTN :39774494

12 Apr, 2025 44.7 Thousand

Purba Medinipur - West Bengal

Tender For supply of torsemide 10 mg tab , loperamide 2 mg tab , sumatriptan 50 mg tab , chlordiazepoxide 5 mg plus clidinium 2 point 5 mg tab , promethazine syp 5mg per 5 ml bottle of 60 ml , digoxin 0 point 5 mg 2ml injection , prochlorperazine mesylate injection , paracetamol with cysteine hcl monohydrate infusion 1000 mg per 100 ml , ivabradine 2 point 5 mg tab , cilnidipine 5 mg tab , ranolazine 500 mg tab , diltiazem 60 mg tab , pioglitazone hydrochloride 15 mg tab , sodium bicarbonate 500 mg tab , nasal decongestant adult drops xylometazoline hcl 0 point 1 percentage w per v nasal drop bottle of 10 ml , corn cap , isabgol husk 3 point 5 gram , trypsin with chymotrypsin tab , disodium hydrogen citrate syrup , calcium 9 mg plus calcium gluconate 50 mg inj for iv use 10 ml injection , amiodarone hcl 150 mg 3 ml inj , heparin 5000 iu per ml inj , atropine sulphate 0 point 6 mg 1 ml inj , paracetamol 150 mg per ml 2 ml iv inj , dexamethasone sodium phosphate 4 point 4 mg equivalent to dexamethasone phosphate 4 mg per ml 2 ml inj , dextrose 25 percentagew 25 ml inj , dobutamine hcl 250 mg 5 ml inj , metoclopramide hcl 5 mg per ml 2 ml inj , inj nitroglycerine 5 mg , tranexamic acid 500 mg tab , carvedilol 3 point 125 mg tab , digoxin 0 point 25 mg tab , nebivolol 5 mg tab , trihexyphenidyl hcl 2 mg tab , entacavir 0 point 5 mg tab , northisterone acetate 5 mg tab , magnesium sulphate 50 percentaged w per v inj , thyroxine sodium 75 mcg tab , thyroxine sodium 50 mcg tab , etophylline 84 point 7mg plus theophylline 22 point 3mg per ml 2 ml inj , sodium bicarbonate 7 point 5 percentage amp of 10 ml , inj thiamine 100 mg per ml 2 ml amp , lorazepam 1 mg tab , diazepam 10 mg 2 ml inj , haloperidol 5 mg per ml inj , rasagiline 1 mg tab , flunarizine 5 mg tab , carbidopa 10 mg plud levodopa 100 mg , quetiapine 25 mg tab , pyridoxine 40 mg tab , microtips size 0 to 200 micro litere packet of 1000 , leflunomide 20 mg tab , bromhexine syp 4 mg per 5 ml bottle of 100 ml , liquid paraffin 3 point 75 mg plus milk of magnesia 11 point 25 mg bottle of 170 ml

	Apr 2025
Su	Mo	Tu	We	Th	Fr	Sa
30	31	1	2	3	4	5
6	7	8	9	10	11	12
13	14	15	16	17	18	19
20	21	22	23	24	25	26
27	28	29	30	1	2	3
4	5	6	7	8	9	10

	Mar 2025
Su	Mo	Tu	We	Th	Fr	Sa
23	24	25	26	27	28	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	29
30	31	1	2	3	4	5

	Apr 2025
Su	Mo	Tu	We	Th	Fr	Sa
30	31	1	2	3	4	5
6	7	8	9	10	11	12
13	14	15	16	17	18	19
20	21	22	23	24	25	26
27	28	29	30	1	2	3
4	5	6	7	8	9	10

	Mar 2025
Su	Mo	Tu	We	Th	Fr	Sa
23	24	25	26	27	28	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	29
30	31	1	2	3	4	5

Optiray Inj Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector