Latest organo clay powder Tenders | Government organo clay powder Tenders

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39848740

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.24) iv solution ringer lactate containing sodium hydroxide 0.32gm, sodium chloride 0.50gm, potassium chloride 40mg, calcium chloride mg, 500ml bottle

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39320533

28 Mar, 2025 20.23 Lacs

Ranchi - Jharkhand

Tender For bid to ras supply of ether solvent , ketamine hcl 50 mg oblique ml 2 ml inj , thiopentone inj of 0point5 g without water for injection , bupivacaine hcl 5 mgobliqueml 20 ml inj , bupivacaine hcl 5 mgobliqueml heavy 4 ml inj , lignocaine hcl 2percent without adrenaline 30 ml inj suitable for ophthalmic use also , lignocaine hcl 2percen with adrenaline , lidocaine oblique lignocaine hcl 2percent with adrenaline , atropine sulphate 0point6 mg 1 ml inj , peracetic acid bott of 810 gm , diclofenac sodium suppository 100 mg , indicator soda lime , paracetamol with cysteine hcl monohydrate infusion 1000mgoblique100ml , common cold tab antihistiminics plus paracetamol 500 mg without pseudoephedrine , etoricoxib 120 mg tab , piroxicam 20 mg tab , fentanyl citrate 50mcgoblique ml 2 ml inj , fentanyl 50mcgoblique ml 10 ml inj , morphine 15 mg 1 ml inj , indomethacin 75 mg sr tab , indomethacin 25mg tab oblique cap , ketorolac 10 mg tab , tramadol hcl 50 mg cap oblique tab , betamethasone 4mg 1ml inj , adrenaline tartrate 1 isto 1000 coma 1 ml inj , levo des cetrizine 5mg tab , dexamethasone 0point5 mg tab , pheniramine maleate inj 22point75 mg per ml amp of 2 ml , methylprednisolone 16 mg tab , promethazine hcl 2point5 percent 25mgm oblique ml 2 ml inj , levetiracetam 100mg oblique ml vial of 5 ml inj , piracetam 400 mg tab , oxcarbazepine 150 mg tab , carbamazepine 200 mg tab , clonazepam 2 mg tab , lorazepam 2mg oblique ml 2 ml inj , diazepam 5 mg tab , lamotrigine 25 mg tab , lamotrigine 50 mg tab , sumatriptan 50 mg tab , topiramate 25 mg tab , rizatriptan 5 mg tab , baclofen 10 mg tab , acebrophylline 100 mg cap , budesunide 1 mg respules , carbimazole 20 mg tab , ethambutol 1200 mg tab , mycophenolate mofetil 250 mg tab , diethylcarbamazine 50mg tab , clofazimine 100mg cap , rifampicin 150mg cap , rifampicin 600 mg plus tab inh 300mg tab , ethambutol 200mg tab , isoniazid 300 mg tab , chloroquine phosphate 250mg tab , primaquine 7point 5mg base tab , silver sulphadiazine 1 percent ointment 20 gm tube , azathioprine 50mg tab , cyclosporine a micro emulsion 25 mg cap , hydroxyurea 500 mg cap , methotrexate 5 mg tab , inj goserelin 3point6 mg prefilled syringe zoladex 3point6 mg , letrozole 2point5 mg tab , levodopa 100 mg and carbidopa 25 mg tab , amantadine 100 mg cap , cabergoline 0point5 mg tab , rasagiline 1mg tab , trihexyphenidyl hcl 2 mg tab , tab levodopa 125 mg , tab levodopa cr 250 mg , tab topiramate 50mg , tab pregablin 75 mg , ferric hydroxide sucrose complex 20 mg in 5ml for injection , erythropoeitin human recombinant 2000 iu , tranexamic acid 500 mg oblique 5ml inj , phytomenadione vit k 1 mg oblique 0point5 ml inj , prasugrel 10 mg tab , fenofibrate 160 mg tab , carvedilol 3point125mg tab , diltiazem 60 mg tab , diltiazem controlled delivery 90mg tab , fenofibrate 200 mg tab , isosorbide dinitrate 10 mg tab , isosorbide mononitrate 20 mg tab , tab perindopril 8mg , esmolol 100 mg 10 ml inj , prasugrel hcl 5 mg tab , lignocaine hcl solution 2percent for iv use 50 ml inj , enalapril maleate 10 mg tab , enalapril maleate 2point5 mg tab , nebivoilol 5mg tab , labetalol hcl 100 mg tab , metoprolol 1 mg oblique ml 5 ml inj , nifedipine retard 20 mg cap oblique tab , propranolol tr 40 mg tab , ramipiril 2point5 mg tab , digoxin 0point25 mg tab

Corporations And Associations And Others

CTN :38767761

04 Apr, 2025 NA

Hisar - Haryana

Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

CTN :39724261

01 Apr, 2025 NA

Jammu - Jammu And Kashmir

Tender For corrigendum : supply of management support , chemicals and glass ware equipments for rate contract on l1 basis - hpcl grade acetonitrile 2.5 ltr, hpcl grade water 1.00 ltr, disodium hyrogen citrate sesquihydrate 500 gm, primay secondary anemia (psa), silica gel 90 c 500 gm, anhydrous sodium acetate (ar) 500 gm, chlorpyripphos (crm), thiamethoxam (crm), imidacloprid (crm), cypermethrin (cmr), spiromesifen (crm), ptfe membrane filter for syringe 0.22 micron 1pck of 50 each, dichloromethane (hplc grade), n-hexane (hplc grade), ethyl acetate (hplc grade), syringe (10-25 microliters), flourisil, nitric acid ar grade, perchloric acid (ar grade), deionised water, standards of elements (nitric acid matrix) 1000 ppm, hydrogen peroxide, pipette - 1-5 ml, pipette - 200-1000 ml, pipette - 20-200 ml, hot plate, beaker 25 ml, beaker 250 ml, beaker 500 ml, beaker 100 ml, volumetric flask 25 ml, volumetric flask 250 ml, volumetric flask 500 ml, volumetric flask 1000 ml, conical flask 25 ml, conical flask 250 ml, conical flask 500 ml, conical flask 1000 ml, burette 25 ml, burette 50 ml, tatration stand, tongs, spatula, measuring cylinders 25 ml, measuring cylinders 250 ml, measuring cylinders 500ml, measuring cylinders 1000 ml, fehling solution a 500 ml, fehling solution b 500 ml, hydrochloric acid 500 ml, sucrose 500 gm, sodium carbonate 500 gm, methylene blue indicator 125 ml, iodine solution 250 ml, sodium hydroxide 500 gm, sulphuric acid 500 ml, sodium thio sulphate 500 gm, starch 500 gm, pot. terrocyanide 500 gm, zinc acetate, sodium bisultate 500 gm

Central Government/Public Sector

CTN :39774589

12 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.

Organo Clay Powder Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government

Corporations And Associations And Others

Central Government/Public Sector