Latest pharmaceuticals product Tenders | Government pharmaceuticals product Tenders

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39222825

28 Mar, 2025 17.13 Lacs

Ferozepur - Punjab

Tender For bid to ras bid to ras tender for supply of bupivacaine hcl 5 mg ml heavy 4 ml inj , diclofenac diethylamine 2.32 quick penetrating topical solution30 ml bottle with metered dose spray , tab topiramate 50mg , artesunate 60mg inj , tab levodopa cr 250 mg , tab fenofibrate 160 mg , fenofibrate 200 mg tab , lignocaine hcl solution 2 percentage for iv use 50 ml inj , labetalol hcl 100 mg tab , labetalol hcl 5mg ml 4ml inj , para dichlorobenzene 2 per w v benzocaine 2.7 per w v chlorbutol 5 perturpentine oil 15 per bott of 10 ml , chlorhexidine gluconate 2 per in 70 per isopropyl alcohol 500 ml bott , glutaraldehyde 2 per with opa with checking strips , povidone iodine solution 5 per bottle of 100 ml , cilnidipine 5 mg tab , tab entacavir 0.5 mg , pantoprazole 40mg plus domperidone 10mg sr , carboprost tromethamine 250 mcg ml 1ml inj , oxytocin 5 units per 1.0ml amp inj , human insulin analogue glargine inj , 100 iu ml recombinant dna origin 300iu disposable pen with 5 needles per pen , olaptadine hcl 0.1 per eye drop with drop dispensor technology bott 5ml , alprazolam 0.25 mg tab , lorazepam 1 mg tab , levosalbutamol sulphate 2.5 ml containing 1.25 mg respule , tiotropium bromide 9 mcg 120 metered dose inhaler , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inhaler of 60 doses , nitrofurantoin 100 mg tab , tetanus toxoid purified absorbed vaccine 0.5ml , tube endo tracheal reinforced pvc size 7.0 with cuff , tube endo tracheal reinforced pvc size 7.5 with cuff , bandage full arm lymphoedema sleeve small classiii 34 46mm hg , bandage full arm lymphoedema sleeve medium class iii 34 46mm hg , bandage full arm lymphoedema sleeve large , comfort caps , lint absorbent cotton , set infusion microdrip presterilised disposable for paediatric use consisting of nontoxic pvc tubing 1700mm with drip chamber of minimum 1000ml , syp osteo calcium bott of 200 ml , tab mecobalamin folic acid pyridoxine b1 b6 , inj neurobion , tab neurobion , fas kit , ecg roll large , troponin t test card , tab premipaxole 0.25 , tab paroxetine , spacer device , tab feropenum 60 mg , eye drape , urostomy kit , syphilis rapid kit , tab leflunomide 20mg , tab misoprostol 200 mg , cap omega 3 f acid m vitamin minerals anti oxidant soft gel , eye drop systane dehydration , tab nitroglycerin 2.6 mg , troponin i test , automatic developer , tab clinidipine 10 mg , sulphamethoxazole 400 mg trimethoprim 80mg tab , ketamine hcl 50 mg ml 2 ml inj , vecuronium bromide 4mg ml 1 ml inj , hydrochlorothiazide 25mg , suture sterilised surg nedled suture polyglactine 910 fast absobable size 1 0 half half cicle tapper cut 40 mm double arm , inj nitroglycerine glyceryltrinitrate 5 mg , trypsin with chymotrypsin tab , levetiracetam 100mg ml vial of 5 ml inj , nortriptyline 25 mg tab , suspensory scrotal , bandage triangular , bandage t shaped , hfnc paediatric circuits hioxy 1570s , hfnc adult circuits hioxy 1570s , surgical gun , inj hcg 5000 , syp multivitamin , rifampicin 150mg cap , tab aceclofenac paracetamol serratiopeptidase , suture vicryl 2 by 0 fast absorb , desmopressin 0.2 mg tab , cholin salicylic acid mouth ulcer gel , mesalazine 2gm sachet , syp ambroxol plus guipheneson , trihexyphenidyl hcl 2 mg tab , atropine sulphate 0.6 mg 1 ml inj , common cold tab cetrizine 5mg paracetamol 500 mg pseudoephedrine 30 to 60mg , tab thalidomide 50mg , ethinyl estradiol 0.035mg cyproterone acetate 2mg pack of 21tablets , dinoprostone gel 0.5mg in 3gm 2.5ml gel syringe , sodium hypochlorite 5 percentage , laryngoscope cells for. size aaa , sodium chloride 3 per inj bott of 100 ml , aa battery , dynapar spray , tetracyclin ip 500 mg cap , cyclosporine a micro emulsion 25 mg cap , cyclosporine a micro emulsion 100 mg cap , clonidine 100 mcg tab , bacillus clausii 2 billion spores 5 ml , metoclopramide hcl 5mg ml 2ml inj , syp sucralfate 1000 mg 10 ml plus oxetacaine 10 mg 10ml bottle of 100 ml , drotaverine hcl 1 per 20 mg ml 2 ml inj , delivery system for salmeterol

State Government

CTN :39614656

10 Apr, 2025 1.66 Crore

Ponda - Goa

Tender For corrigendum : supply of patent veterinary medicine for year 2024-25 - inj. oxytetracycline hcl 200 mg/ml. (l.a.), inj. streptomycin sulphate i.p. 2.5 gmprocaine penicillin g.i.p. 15,lakhs units, penicillin g sodium i.p. 5,lakhs unitssterile water 20ml. 2.5 gms., inj. amoxicillin sodium i.p.3 gms.sulbactum i.p. 1.5gm., inj. sulphadiazine-400 mg trimethoprim 80 mg, amoxycillin sodium ip equivqlent to amoxycillin 200 mg sulbactam sodium usp equivalent to sulbactam 100 mg, inj. metronidazole 5mg/ml, bolus tetracycline hcl 500 mg., powder cephalexin 7.5% w/w, ointment for external use gamma benzene hexachloride 0.10% w/w proflavin hemisulphate 0.10%w/v cetrimide solution ip 0.45% w/v, intrauterine pesseries contains: trimethoprim 0.1 gm. sulpha methoxazole 0.5 gmurea 6 gm.(bolus), liquid uterine ofloxacin 50 mg ornidazole 125 mg urea 50 mg, liq. enrofloxacin 10% i.u., inj. phenylbutazone i.p 150 mg sodium salicylate, inj. dexamethasonesodium 4 mg/ml , adrenochrome 10 mg per ml, inj. iron dextran equivalent to elemental iron 50 mg/ml., inj. cyanocobalamin ip -150 mcgnicotinamide ip -100 mgcholine bitartrate usp- 10 mgd-penthenol ip -15 mgmyo-inositol bp -10 mgbiotin bp -10 mcgglycine ip- 20 mglysine hydrochloride bp- 20 mg, dl- methionine bp - 20 mgbenzyle alcohol ip -20 mg, oral liquid vit. b2 1.25 mgd panthenol 0.65vit b6 0.62 mgvit b126.25 mgnicotinamide37.5 mgcholine chloride 10 mglysine mono-hcl 10 mg per 5 ml, oral liquid ( consisting of liver fraction, yeast extract & nicotinic acid), oral bolus a unique blend of probiotics(saccharomyces cerevisiae, lactobacillus, spororgenes, aspergillus oryzae), minerals (organic zinc & copper, cobalt, chrominium), dl methonine & herbs(allium sativum, zingiber officinale,cichorium intybus, pimpinella, anisum, gentian root powder) carefully selected to give maximum benefit to optimize rumen function, and stimulate appetite and feed intake., permethrin 2 % sulphanilamide 5 % zinc oxide 2 %, inj. atropine sulphate 1mg./ml., inj. polyvalent anti snake venom lyophilized powder, inj. hydroxy progesterone caproate 250 mg/ml, dinoprost tromethamine, inj. xylazine hcl 23.32mg chlorocresol ip(as preservative 0.001%w/v), liquid - phosphorus- 235 g, calcium 103g, magnesium - 108g, sodium- 45.2g, magnanese- 10.8g, zinc- 10.2g, copper- 2.5 g, cobalt- 0.1g, intra mammary infusionprocaine penicillin 100000 i.u.i.p.streptomycin sulphate 100 mg b.p.sulphamezarine 500mghydrocortisone acetate 20 mg in 6 ml , inj. sodium bicarbonate, vitamin a, vitamin e, biotin (vitamin h), methionine, cystine, calcium, sulphur, copper, manganese, selenium, zinc, each 100 ml provides glutaraldehyde -10.0 ml,1,6 dihydroxy 2,5 dioxyhexane-10.3ml, polymethyl, derivatives-4.6 ml, each ml of isofluid contains : isoflupredone acetate i.p. 2mg, acetate ip benzyl 9 mg, alcohol ip (as preservative) water for injection qs to 1 ml, each ml contain:-inj. amoxicilin trihydrate 150mg. , each vial contain:cefquinome sulphate ( sterile) equivalent to anh.cefquinome500 mg. diluent ( each ml contains) sodium bicarbonate .160 mg, water for injection ip . q.s.

Central Government/Public Sector

CTN :39774693

12 Apr, 2025 NA

Kanchipuram - Tamil Nadu

Tender For supply of items for protein studies - ml040 to 500ml 5x tris sds buffer ph 500ml , ml039 to 500ml 2.5 x tris sds buffer ph 500ml , 10x tris glycine sds gel running buffer , acrylamide bisacrylamide solution 30 percent , prestainer protein ladder 10ln , bradford reagent 500ml , tris free base 500gm hhimedia , grm6365 to 500g di sodium hydrogen phosphate dihydrate , potassium dihydrogen , ml016 to 500ml 50 xtae used for gel electrophoresis , ml013 to 500ml to 1m tris cl ph 8 , ml123 to 1ktsilver staining kit , lysozyme 5gm , cms1889 to 1grifampicin 1gm , ammonium sulphate 500 gm , dodecyl sulphate sodium salt for mb 25gm , parafilm m 2 x 250 1pk roll , silver sulphate hi lr 25gm , albumin bovine fraction v 5gm , sd028-1vl penicillin g p 10units , storage vials pp 10ml sterile 300 pk pack tarson , glutaraldehyde solution 25 percent 25ml

CTN :39807687

09 Apr, 2025 NA

Anantnag - Jammu And Kashmir

Tender For e.nit no 03 gmca of 2025 for reagents, drugs and medical consumables - tender for reagents, drugs and disposables., inj. cefuroxime 1.5 g, inj.clindamycin 600 mg, inj.succinylcholine 50mg/ml, inj.vasopressin, inj.physostigmine, inj.anti rabies serum, inj.anti rabies vaccine, inj. piperacillin tazobactum 2.25 gm, inj.isoprenaline 2mg/ml, inj. dextrose normal saline 500 ml, inj. normal saline 500 ml, inj.iron sucrose, inj. tetanus toxoid, inj. diltiazem 5mg, inj.streptokinase, inj.tenectapilase, inj. vitamin k, inj. infusion haemaccel 500 ml, inj. teicoplanin, inj. methyl prednisolone 125 mg, inj. methyl prednisolone 500 mg, inj.xylocard 2%, inj. digoxin, inj.heparin 25000iu, inj.insulin 30/70, inj. haemaccel (3.5% colloidal infusion solution ) 500 ml, inj. biphasic insulin 30/70 40iu, inj.dextrose 5%, inj.paracetamol infusion 100 ml, inj.teicoplanin, iv fluid set, dispo syringe 5ml, dispo syringe 3 ml, dispo syringe insulin 31 g, angiocath 24 g/18 g, urine collection bag adult, glucometer strips along with meter, absorbant cotton 500 gm, gauze cloth than, sodium hypochlorite 5% and 10 %, av tubing blood lines, av fistula needles 16/17 g, citrosterile disinfectant 5 ltr can, diasafe plus filter, haemobicarb part a+part b, introducer needles, disposable pressure transducer, transducer protector, hollow fiber dialyzer, femoral catheter 14cm*14cm, ecg paper 210mm 20 mtr (ecg 9108 z-fold paper), antisera d 10 ml, widal kit, crp omega kit, aso kit, distilled water can 5 ltr, erba diluent h560, erba lyse -i h560, erba lyse -ii h560, glutaraldehyde solution(cidex) 5ltr, hiv elisa, dispo shoe cover, dispo blanket cover, dispo gown, ahg gel cards -matrix, abo gel cards -matrix, lyss -matrix 250ml, ahg coombs sera 5 ml, antisera abd 10 ml (tulip), anti sera ab 10 ml, anti sera a1 5 ml, pipette multi channel 10-100 micro litre, pipette multi channel 100-1000 micro litre, formalin liquid 5 ltr, hydrophilic foldable lens a/s, hydrophobic foldable lens a/s, rigid lens a/s, iris claw lens a/s, glass slides 75*25 mm 1*50, inj.erythropoitin 10000iu pfs, inj carboprostate tromethamine 250 mcg, inj etomidate, inj glycine 3000ml, inj valthamate bromide, macintosh apparan, mersilk (1) 5062, dispo molin sheets, monocryl (3-0), nasal oxygen set paediatric/ neonate/ adult, sr. blood urea (tulip/ranbaxy/meril/span), antisera-d 10ml (tulip), sr. albumin (tulip/ranbaxy/meril/span), sr. alkaline phosphate (tulip/ranbaxy/meril/span), sr. calcium (tulip/ranbaxy/meril/span), sr. creatinine (tulip/ranbaxy/meril/span), sr. phosphorous (tulip/ranbaxy/meril/span), sr. sgot (tulip/ranbaxy/meril/span), sr. sgpt (tulip/ranbaxy/meril/span), sr. total protein (tulip/ranbaxy/meril/span), stromatolyzer 500ml reagent for sysmex machine, cell pack 20 liter reagent for sysmex machine, tablet misoprostol 200mg, umbilical card clamp, usg paper type-v (sony), dynoprostone gel, iv set/ drip set, cautery pencil, ctg paper 151mm*90mm*150 sheets (bristal indian), phenyl black 5liter, cell clean 5ml sysmex, cell cleaner erba 5ml, qc erba high/low/normal, qc sysmex high/low/normal

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

CTN :39771617

26 Mar, 2025 NA

Delhi - Delhi

Tender For rfp invitation of bids for supply of medical stores under price agreement for fy 2025 to 26 - 2% glutaraldehyde solution 5ltr , accu-check active test strips (pkt of 50) , acimol-sp tab , acitrom 2mg tab , acyclovir oint , adapalene gel 0.1% oestrogel , aerocort inhaler , albendazole syp bott of 10 ml , aldactone 50 mg tab , alfoo 10mg tab , allegra syp , allopurinol 300 mg tab , amlodipine 10 mg tab , amlodipine 2.5 mg tab , ankle support l / xl / m / s , anovate oint , antacid gel 170ml , apixaban 5 mg tab , aquagest aq 25 mg inj , argiprine sachet , aripiprazole 15 mg tab , arm sling pouch , asthalin solution 10ml , atorvastatin 10 mg tab , avil inj , azelic acid cream 20% 5gm , azithral 500 tab , bandaid waterproof , battery 1.5 v a++ , battery 1.5 v a+++ , bd ultra fine pen needles , becovit tab , benidipine 8 mg tab , betadine 5% 100ml , betadine gargle , betahistine 16 mg tab , bethanechol 25 mg tab , bicalvit 500 mg tab , bisoprolol 5 mg tab , brinzolamide eye drop , bromhexine syp , broxyl t syp , budecort 0.5 respules , buspirone 5 mg tab , cabergolin 0.5 mg tab , calamine lotion , calcirol sachets , candibiotic ear drops , candid b cream , candid oint , candid tv shampo , cap acebrophylline , cap amoxycillin 500mg , cap dhea , cap dimethyl fumarate 240 mg , cap fexofenadine 180 mg , cap fludac 20 mg , cap isoniazid 300 mg , cap menopace , cap pancroflate 25000 iu , cap pangraf 1 mg , cap rifampicin 600mg , cap ziprasidone 20mg , cap zonisamide , carvedilol 6.25 mg tab , cefexime 200mg tab , ceftum 500 mg tab , celin 500mg tab , cetrizine 10 mg tab , chloramphenicol eye applicap , chymoral forte tablet , cilnidipine 10 mg tab , cilnidipine 5 mg tab , ciplox d eye drop , ciplox tz tab , ciprofloxacin 500 mg tab , citicolin 500mg tab , citralka syp , clindamycin 300 mg cap , clonazapam 0.5 mg tab , clonazapam 1 mg tab , clonazepam 0.25 mg tab , clozol pulv , computed radiography film (fuji) 14" x 17" (pack of 100 sheets) , computed radiography film (fuji) 08" x 10" (pack of 150 sheets) , computed radiography film (fuji) 10" x 12" (pack of 150 sheets) , corn cap(pack of 4) , crepe bandage 10 cm , crepe bandage 15 cm , crisanta tab , crp kit(20 test) , dabigartan 110 mg tab , dapagliflozin 5 mg tab , dengue combo (sd)ns1,igg,igm (10 test) , desonide lotion , diacerin 50mg tab , dienogest 2 mg tab , dilzem sr 30 mg tab , dilzem sr 60 mg tab , dilzem sr 90 mg tab , dipsalic oint , doxycycline cap 100 mg , duloxetin 20 mg cap , duolin respules , duonase nasal spray , dynapar spray , dytor 10 mg tab , easy breath cap , eberconazole cream 10 gm , ecg / ultrasound gel 250ml , ecg paper a4 size (210mm x 295mm x 100sheats) , ecosprin 75mg tab , edta vaccutainer(100 piece packet) , eflora oint , elcephase sr 1gm tab , emset inj , enalapril 5 mg tab , enterogermina respule , erba bilirubin total (6x44ml/6x12.3ml) , erba cholestrol (10x44ml) , erba creatinine (5x44ml/5x11 ml) , erba em 200 xl hdl , erba em 360 lyze(3 x 500ml) , erba glucose (10x44ml) , erba h 360 dil 20l , erba h clean(4 x 50ml) , erba norm (4x5ml) , erba path (4x5ml) , erba sgot el (6x44ml /6x12.5ml) , erba sgpt el (6x44ml /6x12.5ml) , erba triglyceride (5x44ml/5x11 ml) , erba urea (5x44ml/5x11 ml) , erba uric acid (5x44ml/5x11ml) , esmoprazole 20 mg tab , etoricoxib 120mg tab , etoricoxib 60mg tab , ezetimibe 10mg tab , febuxostat 40mg tab , fefol-z tab , femilon tab , fenofibrate 145 mg tab , fenofibrate/lipicard 160 mg , fexofenadine 120mg tab , fincar 5mg tab , flomist 0.005% nasal spray , flunarizine 10mg tab , flunarizine 5mg tab , flur eye drop , folitas tab , foracort 200 mcg rotacap , foracort inhaler 200 , formalin solution(400 ml bott) , fosfomycin sachets , gabapentin 100mg tab , ganaton 50mg tab , genteal eye drop , genteal gel (eye) , gloves sterile (pkt of 25 pair) , glucose powder(500 gm) , glucostrip contour ts (pack of 50) , gluosamine 500mg tab , h cort 100mg inj , hand gloves (pack of 100) , hbs ag card test , hcg 10000 inj , hcv card test , he

State Government

CTN :39575290

27 Mar, 2025 NA

Chandigarh - Chandigarh

Tender For surface disinfectant in solution form 500 ml bottle (100 gm contain 1,6-dihydroxy 2,5-dioxahexane (chemically bound formaldehyde)-11.2 gm glutaraldehyde-5.0 gms, benzalkorium chloride 5.0 gms, alkyl urea derivative 3.0 gms)

CTN :39567023

25 Mar, 2025 NA

Delhi - Delhi

Tender For rfp invitation of bids for supply of medical stores under price agreement for fy 2025 to 26 - procurement of identified drugs for price agreement for fy 2025-26, 2% glutaraldehyde solution 5ltr, accu-check active test strips (pkt of 50), acimol-sp tab, acitrom 2mg tab, acyclovir oint, adapalene gel 0.1% oestrogel, aerocort inhaler, albendazole syp bott of 10 ml, aldactone 50 mg tab, alfoo 10mg tab, allegra syp, allopurinol 300 mg tab, amlodipine 10 mg tab, amlodipine 2.5 mg tab, ankle support l / xl / m / s, anovate oint, antacid gel 170ml, apixaban 5 mg tab, aquagest aq 25 mg inj, argiprine sachet, aripiprazole 15 mg tab, arm sling pouch, asthalin solution 10ml, atorvastatin 10 mg tab, avil inj, azelic acid cream 20% 5gm, azithral 500 tab, bandaid waterproof, battery 1.5 v a++, battery 1.5 v a+++, bd ultra fine pen needles, becovit tab, benidipine 8 mg tab, betadine 5% 100ml, betadine gargle, betahistine 16 mg tab, bethanechol 25 mg tab, bicalvit 500 mg tab, bisoprolol 5 mg tab, brinzolamide eye drop, bromhexine syp, broxyl t syp, budecort 0.5 respules, buspirone 5 mg tab, cabergolin 0.5 mg tab, calamine lotion, calcirol sachets, candibiotic ear drops, candid b cream, candid oint, candid tv shampo, cap acebrophylline, cap amoxycillin 500mg, cap dhea, cap dimethyl fumarate 240 mg, cap fexofenadine 180 mg, cap fludac 20 mg, cap isoniazid 300 mg, cap menopace, cap pancroflate 25000 iu, cap pangraf 1 mg, cap rifampicin 600mg, cap ziprasidone 20mg, cap zonisamide, carvedilol 6.25 mg tab, cefexime 200mg tab, ceftum 500 mg tab, celin 500mg tab, cetrizine 10 mg tab, chloramphenicol eye applicap, chymoral forte tablet, cilnidipine 10 mg tab, cilnidipine 5 mg tab, ciplox d eye drop, ciplox tz tab, ciprofloxacin 500 mg tab, citicolin 500mg tab, citralka syp, clindamycin 300 mg cap, clonazapam 0.5 mg tab, clonazapam 1 mg tab, clonazepam 0.25 mg tab, clozol pulv, computed radiography film (fuji) 14" x 17" (pack of 100 sheets), computed radiography film (fuji) 08" x 10" (pack of 150 sheets), computed radiography film (fuji) 10" x 12" (pack of 150 sheets), corn cap(pack of 4), crepe bandage 10 cm, crepe bandage 15 cm, crisanta tab, crp kit(20 test), dabigartan 110 mg tab, dapagliflozin 5 mg tab, dengue combo (sd)ns1,igg,igm (10 test), desonide lotion, diacerin 50mg tab, dienogest 2 mg tab, dilzem sr 30 mg tab, dilzem sr 60 mg tab, dilzem sr 90 mg tab, dipsalic oint, doxycycline cap 100 mg, duloxetin 20 mg cap, duolin respules, duonase nasal spray, dynapar spray, dytor 10 mg tab, easy breath cap, eberconazole cream 10 gm, ecg / ultrasound gel 250ml, ecg paper a4 size (210mm x 295mm x 100sheats), ecosprin 75mg tab, edta vaccutainer(100 piece packet), eflora oint, elcephase sr 1gm tab, emset inj, enalapril 5 mg tab, enterogermina respule, erba bilirubin total (6x44ml/6x12.3ml), erba cholestrol (10x44ml), erba creatinine (5x44ml/5x11 ml), erba em 200 xl hdl, erba em 360 lyze(3 x 500ml), erba glucose (10x44ml), erba h 360 dil 20l, erba h clean(4 x 50ml), erba norm (4x5ml), erba path (4x5ml), erba sgot el (6x44ml /6x12.5ml), erba sgpt el (6x44ml /6x12.5ml), erba triglyceride (5x44ml/5x11 ml), erba urea (5x44ml/5x11 ml), erba uric acid (5x44ml/5x11ml), esmoprazole 20 mg tab, etoricoxib 120mg tab, etoricoxib 60mg tab, ezetimibe 10mg tab, febuxostat 40mg tab, fefol-z tab, femilon tab, fenofibrate 145 mg tab, fenofibrate/lipicard 160 mg, fexofenadine 120mg tab, fincar 5mg tab, flomist 0.005% nasal spray, flunarizine 10mg tab, flunarizine 5mg tab, flur eye drop, folitas tab, foracort 200 mcg rotacap, foracort inhaler 200, formalin solution(400 ml bott), fosfomycin sachets, gabapentin 100mg tab, ganaton 50mg tab, genteal eye drop, genteal gel (eye), gloves sterile (pkt of 25 pair), glucose powder(500 gm), glucostrip contour ts (pack of 50), gluosamine 500mg tab, h cort 100mg inj, hand gloves (pack of 100), hbs ag card test, hcg 10000 inj, hcv card test, heel pad cushion, hetrazan 100mg tab, hexidine mouth wash 150 ml, hiv card test, hydroclorothiazide

Pharmaceuticals Product Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

corporations/Associations/Others

State Government