Latest primer wood Tenders | Government primer wood Tenders

Central Government/Public Sector

CTN :38813549

22 Mar, 2025 NA

Gwalior - Madhya Pradesh

Tender For bid to ras tender for supply of modified oligonucleotides primer and probes - ft tul4 gc 1 f aacaacccaagaaatccaacaaa 200nm hplc-dry , ft-tul4-gc-1-r-agaggctttagcaagctctga-200nm-hplc-dry , ft tul4 gc 2 f acaaagtgttgataaaacaacccaa 200nm hplc-dry , ft-tul4-gc-2-r-tcaatgctgtccatgtccca-200nm- hplc-dry , ft-fpoa-gc-1-f-cttatgtttcggcatgtgaatagt-200nm-hplc-dry , ft-fpoa-gc-1-r-tctttaagtggagctgatacgc-200nm-hplc-dry , ft-fpoa-gc-2-f- tcttatgtttcggcatgtgaatag-200nm-hplc-dry , ft-fpoa-gc-2-r- cttctttaagtggagctgatacgc-200nm-hplc-dry , ft-igle-gc-1-f-aggatggcaaaaacaaggagaag-200nm-hplc-dry , ft-igle-gc-1-r-tgaaaatatggtctgcttttgaca-200nm-hplc-dry , ft-igle-gc-2-f-ggcaaaaacaaggagaagtcaatg-200nm-hplc-dry , ft-igle-gc-2-r-tgaaaatatggtctgcttttgacat-200nm-hplc-dry , ft-tolc-gc-1-f-agttaacattatatcttttaggttttttgggg-200nm-hplc-dry , ft-tolc-gc-1-r-ttactccgttgcaatctgcgatatt-200nm-hplc-dry , ft-tolc-gc-1-f-cattatatcttttaggttttttggggttt-200nm-hplc-dry , ft-tolc-gc-1-r-gcaatctgcgatattatatctgtagt-200nm-hplc-dry , bg-atpd-1-f-gctagaggtcgcacttcattta-200nm-hplc-dry , bg-atpd-1-r-taccaaccggcactgaaatag-200nm-hplc-dry , bg-atpd-2-f-cacttcatttaggcgacgatact-200nm-hplc-dry , bg-atpd-2-r-ttgtctgtgaatcggatctttctc-200nm-hplc-dry , bg-rec-a-1-f-gctttccggagcaatcaataag-200nm-hplc-dry , bg-rec-a-1-r-cacttctaaccgtacagaggaataa-200nm-hplc-dry , bg-rec-a-2-f-gctgaaattgaaggagacatgg-200nm-hplc-dry , bg-rec-a-2-r-gacttattgattgctccggaaag-200nm-hplc-dry , bg-sod-sol-sym-f-acagtggagattagccaagaaacac-200nm-hplc-dry , bg-sod-sol-sym-r-gtacatacagcgaaccctgaatttc-200nm-hplc-dry , bg-its region-f-cattcgattcttcgagatg-200nm-hplc-dry , bg-its region-r-ggtcttacttttgaatgtgatgtc-200nm-hplc-dry , ms2 rnarep 1 f cggctcaaatccgttggtatag 200nm hplc dry , ms2 rnarep 1 r ggaatcggatgcagacgataag 200nm hplc dry , ms2 rnarep 2 f gctctgagagcggctctattg 200nm hplc dry , ms2 rnarep 2 r cgttatagcggaccgcgt 200nm hplc dry , ms2 lysis prot 1 f cagcaatcgcagcaaactc 200nm hplc-dry , ms2-lysis prot-1-r-gagagaaagatcgcgaggaag-200nm-hplc-dry , ms2-lysis prot-2-f-cctcagcaatcgcagcaaa-200nm-hplc-dry , ms2-lysis prot-2-r-ggaagatcaatacataaagagttgaacttc-200nm-hplc-dry , ms2-hmp-1-f-aacgggtgagtccatcataag-200nm-hplc-dry , ms2-hmp-1-r-cgatgcatggctgagatttg-200nm-hplc-dry , ms2-hmp-2-f-ccagacaacgtgcaacatatc-200nm-hplc-dry , ms2-hmp-2-r-ccacactatacctagtgggttc-200nm-hplc-dry , ms2-cotp-1-f-ctgcgcagaatcgcaaatac-200nm-hplc-dry , ms2-cotp-1-r-gaagctctacaccaccaaca-200nm-hplc-dry , ms2-cotp-2-f-cgttcacaggcttacaaagtaacct-200nm-hplc-dry , ms2-cotp-2-r-ccaacagtctgggttgccac-200nm-hplc-dry , pa-auto-synth-1-f-ccatgagaaagtgtgggaaatg-200nm-hplc-dry , pa-auto-synth-1-r-gttgccgaactgatgatgtattc-200nm-hplc-dry , pa-auto-synth-2-f-gctaccgatacagcgtcttt-200nm-hplc-dry , pa-auto-synth-2-r-cgtagcgatcatattcctgtcc-200nm-hplc-dry , pa-chor-mut-1-f-ctcttggatcactctcttctgc-200nm-hplc-dry , pa-chor-mut-1-r-gaggcagatcctcaataggtaaat-200nm-hplc-dry , pa-chor-mut-2-f-cgtttgtgcacgctttgat-200nm-hplc-dry , pa-chor-mut-2-r-gttgtatctgctgtctggtctc-200nm-hplc-dry , pa-dna-heli-rep-1-f-gcgatcgcagcaggataata-200nm-hplc-dry , pa-dna-heli-rep-1-r-ttcacgcacctcctgattac-200nm-hplc-dry , pa-dna-heli-rep-2-f-ccggacgcagtacaaagatta-200nm-hplc-dry , pa-dna-heli-rep-2-r-ccagagatgcgataagggatg-200nm-hplc-dry , pa-scar-mar-f-atgagccctgtgatcaggaagatcg-200nm-hplc-dry , pa-scar-mar-r-acgatgagccttctcagcaaatgcg-200nm-hplc-dry , genomic region f 261 r 369 f-ggttcgtcaaggactggttt 200nm hplc-dry , genomic region f-261 r-369-r-ttgaacagcatcggactcag-200nm-hplc-dry , genomic region f- 119 r-369-f-actgctggcggaaaatgaga-200nm-hplc-dry , genomic region f- 119 r-369-r-ttgaacagcatcggactcag-200nm-hplc-dry , x174 m spi prot 1 f-gtttggttcgctttgagtcttc 200nm hplc-dry , x174m spi prot 1 r cacacagtccttgacggtataa 200nm hplc dry , x174-m-spi-prot-2-f-cccgactgcctatgatgtttat-200nm-hplc-dry , x174-m-spi-prot-2-r-gtcaatagtcacacagtccttga-200nm-hplc-dry , x174-terminase-1-f-cgacctttcgccatcaacta-200nm-hplc-dry , x174-terminase-1-r-cgaacgtgccaagcatattaag-200nm-hplc-dry , x174-terminase-2-f-ctttcgccatcaactaacgattc-200nm-h

Central Government/Public Sector

CTN :39395776

26 Mar, 2025 NA

Chennai - Tamil Nadu

Tender For corrigendum : lwscz shell kit (a) lscz - one coach set of roof, 2 mm sidewall and end wall for lwscz coaches. 1) sidewall assembly to drg.no. (329) icf/sk3-1-4-091, alt 'b' , col- 1 - 1 no 2) roof assembly to drg.no. (lwscz) 73916001, alt 'c', col-i - 1 no, 3) end roof assembly to drg.no.(ls) 58116066, alt 'g', col-i - 2 nos. welding pin to drg no 81410012 alt nil to be asse mbled on roof and sidewall 4) endwall to drg. no. (lslrd) 74115001, alt 'f'-2 nos the firm shall fulfil the requirement as per icf//md/specn.200, issue status 01, rev 04 with amendment no. 01. the firm shall fulfil the requirement as per icf/md/spec-315,issue status-01,rev.00 firm ha s to supply roof and sidewall without applying etch primer and the firm has to apply etch primer on ro of and sidewall in icf after shell assembly. (b)one coach set of body shell items and partition frames for lwscz2(814) coaches to drg nos, 1. 81410002, alt nil- 1no 2. 81410005, alt 'c'- 1 no 3 . 58210036, alt 'a'- 2 nos 4. 67010011, alt 'a'- 2 nos 5. 58110017, alt 'b'- 2 nos 6. aag10457, alt nil-4 nos 7. aab10338, alt nil-16 nos 8. 58110015, alt 'a'- 6 nos 9. 58110016, alt 'a'- 3 nos (c) under fra me arrangement to drg no. 81411001 alt 'c' the manufacturing facility as per icf/md/spec- 147, issue status-01 rev.02 with amendment no.01. special condition : a) -packing as per icf/j &t/misc-2201, alt 'e', safety instruction as per icf/j&t/sk-1867, alt. 'nil' -packing as per icf/j &t/sk-1809, alt 'a'. b) - packing condition as per icf/j&t/sk-1865, alt "a". c)packing condition as per drg.no.icf/j&t/misc-2487, alt 'b' the underframe should be supplied as normal side up and side bearer side down. [safety item ]

Central Government/Public Sector

CTN :39702400

21 Mar, 2025 NA

Tambaram - Tamil Nadu

Tender For corrigendum : supply of four wheeled platform trolley of size 5 feet x 3 feet having load capacity of 1000 kg. main ch assis frame to be made out from m.s angle of size 50 x 50 x 6 mm duly covered with 16 swg sheet. all she et portions are properly electrically welded construction and fitted with 04 nos. of wheel of size 16 inch x 4 inch and equipped with double ball bearing. out of 04 nos. wheels, rear 02 nos. wheel shall be on fixed ma chine angle and balance 02 nos. in front shall be directly coupled with turn table arrangement complete wit h tubular t handle for pulling and painted anti-corrosive primer and enamel paint finish. [ warranty perio d: 30 months after the date of delivery ]

corporations/Associations/Others

CTN :39761986

01 Apr, 2025 NA

Margao - Goa

Tender For supply of paint ready mixed golden yellow , enamel black oil paint , bus green oil paint , hammertone paint gray colour any brand , paint ready mixed white brushing finishing interior semi gloss , paint ready mixed red oxide zinc chrome primer , paint ready mixed zink chrome yellow primer , aluminium silver paint , paint signal red for general purpose , paint roller with handle of size 6 inch , paint roller sleeve without handle of size 6 inch

State Government

CTN :39666262

01 Apr, 2025 27.19 Lacs

Bhavnagar - Gujarat

Tender For supply and application of metal protective compound for various pipe lines and tanks in mmd area of unit no.1&2 at bltps. - zinc primer ( epoxy base - 60 (percentage) zinc ), 2, 1800, square metre, 800, charges for the application of one coat of zinc primer & three coats of metal protective compound along with fibre cloth at various locations of tmd areas as per scope of works & instruction of eic.,

Central Government/Public Sector

CTN :39722386

07 Apr, 2025 NA

Dakshina Kannada - Karnataka

Tender For supply of thinner, enamel ordinary in 4/5 ltr tins. , enamel paint opaline green as per is2932 , red oxide metal primer as per is 2074(1992

Central Government/Public Sector

CTN :39751414

29 Mar, 2025 NA

Haridwar - Uttarakhand

Tender For supply of full gloss polyurethane finish ing paint bhel code aa5610042020 , high build intermediate epoxy paint bhel code hw5610012996 , epoxy based zinc rich primer paint (two pack) bhel code hw5610014000 , full gloss polyurethane finishing paint (liquid) bhel code hw5610042933

Central Government / Public Sector

CTN :39763114

25 Mar, 2025 NA

Tirupati - Andhra Pradesh

Tender For supply of adhesion promoting primer

Central Government/Public Sector

CTN :39721814

07 Apr, 2025 NA

Kothagudem - Telangana

Tender For construction work of barrack - bricks red bhatta , 10mm stone aggregates , 20mm stone aggregates , 40mm stone aggregates , coarse sand , fine sand , moorum filling material , portland cement , vitrified floor tile 60x60 cm , white cement , paint primer , distemper paint , acrylic smooth exterior paint , synthetic enamel paint , cement base wall care putty , roller brush , 100mm brush , tmt bar 12 mm 880 kg and 08 mm 250kg , binding wire , rectangular hallow section pipe 50 25 2/5 mm , gi plan sheet barge board upto 300 mm and gutter 600 mm over all girth , cgi precoated galvanised iron sheet 12/3 42 no , cgi precoated galvanised iron sheet 6/3 22nos , self screw , welding rod , 4 inch cutting blade , iron angle frame for door angle size 40x40x6 mm , wooden door 35 mm thick shutters , iron angle window size 1/2x1/2 mtr with grill bar and glass panes fix with silicon complete all fitting accessories , tower bolt , handle , aldrop , calcium silicate reinforced with fibre and natural filler false ceiling tiles of size 595x595 mm , 4 mm dia steel wire rope lock u clamp set pu coated , aluminium with stainless steel ss coating 4 ftx 3 mtr mosquito net wire and meshs , 1 1/5 sqmm single core wire , 2 1/5 sqmm single core wire , 6 amp switch , 6 amp socket 5-pin , 16 amp switch , 16 amp socket , ceiling rose , 1200mm ceiling fan , modular fan regulator , led tube light 20 watt , 16 amp single pole mcb , 32 amp double pole mcb , mcb box 8 way , pvc board size 9x8 inch , 25 mm casing capping , 25 mm casing capping clip , screw 1 1/5inch , 6 mm pvc gatti , pvc 6 way board , insulation tap , labour charge

State Government

CTN :39751747

29 Mar, 2025 NA

Murad Nagar - Uttar Pradesh

Tender For providing of professional painting service - painting of 220kv ct juction box of different 220kv bay with one coat of red oxide primer and two coat of selves enameled painting nerolacberger asian paint after proper cleaningremoving of rust dust old paint of all ..

Primer Wood Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors