Web Analytics Made Easy - StatCounter

Ptfe Thread Sealant Tape Tenders

Get complete information related to latest Ptfe Thread Sealant Tape Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ptfe Thread Sealant Tape Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ptfe Thread Sealant Tape Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39541968 Due date: 29 Mar, 202529 Mar, 2025 6.00 Lacs
Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39827820 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For supply of public health materials in hulical town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39827891 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For supply of public health materials - public health materials, bleaching powder(p/h), bleaching powder(w/s), white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, lyzol floor cleaner disinfectant, sodium hypochlorite solution, mask, emi stock solution, soap oil, (harvicide), fogging gas cylinder, rubber glouse, cotton gloves, rain coat(male & female), life jacket with reflector, helmet, gum boot, plastic basin, 50 lit syntax backet, white lime powder, , ( ), ( ), ( ), , ( ), ( ), ( ), ( ), , , , , 80 lit syntax bucket, 4 pin hook with pipe handle (sumal), 4 pin hook with pipe handle (big), grass knife, hand sanitizer, sprayers(12 liters capacity), sprayers(16 liters capacity), plastic koodai(sumall), syntex bucket (50 lit), syntex bucket (70 lit), plastic koodai(big), 24 mm crowbar, 25mm crowbar, shawel, water testing kit

CTN :39793885 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For supply of public health materials at naduvattam town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39794075 Due date: 28 Mar, 202528 Mar, 2025 50.00 Lacs
Tender For ovtp supply of public health materials - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39809138 Due date: 28 Mar, 202528 Mar, 2025 10.00 Lacs
Tender For supply of public health materials in sholur first grade town panchayat 2025-2026 - bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39776691 Due date: 28 Mar, 202528 Mar, 2025 19.3 Thousand
Tender For supply of hns and stationaries to gh tiptur - thread no 10_gh tiptur, thread no 40_gh tiptur, floor rubbing brush_gh tiptur, safety blade_gh tiptur, safety razor_gh tiptur, electrical bulb led_gh tiptur, lock seven lever_gh tiptur, lock five lever_gh tiptur, match 1 box_gh tiptur, three cell torch_gh tiptur, two cell torch_gh tiptur, torch bulb_gh tiptur, torch cell big size_gh tiptur, nail cleaning brush_gh tiptur, vim powder_gh tiptur, plastic container_gh tiptur, life boy soap_gh tiptur, office tray_gh tiptur, plastic jug_gh tiptur, plastic bucket_gh tiptur, candle_gh tiptur, nusigulige_gh tiptur, rexin sheet_gh tiptur, mosquito machine & liquide_gh tiptur, plastic besin_gh tiptur, washing soap (arasan /rin)_gh tiptur, pen torch cell_gh tiptur, sabina powder_gh tiptur, hand wash liquid_gh tiptur, washing powder (rin, surfexcel)_gh tiptur, cfl bulb_gh tiptur, tube light led_gh tiptur, white concentrated phenail_gh tiptur, bleaching powder_gh tiptur, cleaning stick_gh tiptur, wall cleaning stick_gh tiptur, washing acid_gh tiptur, blue_gh tiptur, scent_gh tiptur, utility glove (small, medium & large)_gh tiptur, gum boot (small, medium & large)_gh tiptur, hypoclorite solution 10%_gh tiptur, dry mop_gh tiptur, wet mop_gh tiptur, bathrooms door mat_gh tiptur, door mat_gh tiptur, liners (black & green)_gh tiptur, soap oil_gh tiptur, three bucket system_gh tiptur, foot operating dustbin (red, blue, yellow, green & black) 40l_gh tiptur, bmw liners (red, yellow & blue)_gh tiptur, ppc container_gh tiptur, multipurpose transparent drug tray_gh tiptur, water wiper_gh tiptur, plastic brooms like coconut broom_gh tiptur, dust removal stick_gh tiptur, long note book 400pages_gh tiptur, long note book 300 pages_gh tiptur, long note book 200 pages_gh tiptur, long note book 100pages_gh tiptur, a4 paper reem(500sheets)_gh tiptur, white sheets reem(500sheets)_gh tiptur, legal sheet reem (500sheets)_gh tiptur, cell (use & throw battery)_gh tiptur, tag bundle(100 in a bundle)_gh tiptur, pin 1 box_gh tiptur, cover big_gh tiptur, cover small_gh tiptur, gum bottle big (500ml)_gh tiptur, gum bottle small(250ml)_gh tiptur, cash book_gh tiptur, attendance 200 pages_gh tiptur, correction pen(whitener)_gh tiptur, calculator_gh tiptur, pad ink bottle small(500ml)_gh tiptur, pad big size_gh tiptur, file printed_gh tiptur, stapler pin 1 box small_gh tiptur, stapler medium_gh tiptur, carbon sheet blue_gh tiptur, ink pad big size_gh tiptur, ruler_gh tiptur, table desk board big size_gh tiptur, paper wheight_gh tiptur, paper punching machine_gh tiptur, poker good quality_gh tiptur, file boards_gh tiptur, file rapper_gh tiptur, calling bell_gh tiptur, pencil_gh tiptur, sketch pen_gh tiptur, button pin 1 box_gh tiptur, flof_gh tiptur, note sheet_gh tiptur, comfort liquid for cloth_gh tiptur, washing liquid_gh tiptur, marker_gh tiptur, hi lighter_gh tiptur, cello colour tapes (green, red, yellow blue, transparent )_gh tiptur, torch chargable_gh tiptur, cell torch_gh tiptur, magnifying glass_gh tiptur, printed envelop cover 8x10 & 10x12_gh tiptur, stapler pin 1 box big_gh tiptur, red woolen blankets_gh tiptur, bed spread for single bed_gh tiptur, pillows_gh tiptur, pillow covers_gh tiptur, single cushion beds_gh tiptur, colour woolen blankets_gh tiptur

Central Government / Public Sector

CTN :39809503 Due date: 14 Apr, 202514 Apr, 2025 NA
Tender For supply of plumbing items - 1.5 inches cpvc pipes , 1.5 inches cpvc in-trhread brass coupling , 1.5 inches cpvc elbow , 1.5 inches cpvc couplings , 1.5 inches cpvc ball value , 1.5 inches cpvc unions , 1.5 inches upvc t junction , 1.5 inches upvc unions , 1 inches cpvc ball value , 1 inches cpvc tank nipple , 1 inches cpvc in-thread brass , 2 inches x 1 inches cpvc reducer - 2 1e , ashirvad 118 gum solution , teflon tape , hexa blade , 1.5 inches g.i. clamps , 2.5 inches nails , 1.5 inches upvc out-thread couplings , 2 inches pipe , 2 inches elbow , 2 inches couppling , 2 inches mabt , 2 inches fabt , 2 inches union , solution

State Government

CTN :39391119 Due date: 01 Apr, 202501 Apr, 2025 NA
Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, acyclovir 3%(ointment),ointment, alfacalcidol 0.25mcg, calcium 200mg (0.25mcg+200mg),capsule, alfuzosin (10mg),tablet /capsule, amantadine (100mg),tablet, amisulpride (50 mg),tablet, anti d immunoglobulin for iv/im use (monoclonal) (150mcg (1ml vial)),injection, anti thymocyte globulin (250mg/5ml),injection, atorvastatin + asprin (10mg + 75mg),tablet or capsule, bisoprolol (5 mg),tablet, busulphan(60mg/10ml),injection, canagliflozin (100 mg),tablet, carbamazepine(100 mg / 5ml 100ml bottle),syrup, chlorthalidone (12.5mg ),tablet, clobetasole propionet 0.05% + salicylic acid 3% (15gm tube),ointment, cyclosporine (100mg),capsule, cyclosporine(100mg/ ml),solution, cyclosporine(50mg),capsule, dacarbazine 200mg (10mg/ml),injection, diclofenac+paracetamol+chlorzoxazone (50mg + 325mg + 250mg),tablet, diloxanide furoate (tablet 500 mg),tablet, etophylline + theophylline sr tablet 231mg + 69mg,tablet, fat emulsion 20% (250ml),injection, ferric carboxymaltose 50mg/ml(20ml vial),injection, fluvoxamine (100mg),tablet, fluvoxamine (50mg),tablet, formoterol 6mcg + budesonide 400mcg (30 cap x 6 pack with 1 dispensing device),rotacaps, gatifloxacin (0.3% ),eye drop, glargine 100 iu /ml, 3ml cartridge inj. (firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost)(100 iu /ml),cartridges, glimepride 2mg + metformin 1000mg (tab),tablet, hepatitis b immunoglobulin (100 iu/vial),vial, human insulin regular/soluble (100iu/ml (10ml vial)),injection, hydrocortisone sodium succinate inj. 200mg vial,injection, hydroquinone 2% + mometasone 0.1% + tretinoin0.025% (5 gm tube),cream, hydroxy propyl methyl cellulose injection 2% (3ml prefilled syringe),syrings, ipratropium bromide inhaler 20mcg per puff (200 metered dose container),inhaler, irinotecan hydrochloride (100mg),injection, labetalol 5mg/ml (4ml ampl),injection, lactulose (10gm/15ml (100 ml bottle)),solution, lamotrigine dt tab (100mg),tablet, levetiracetam 100mg/ml syrup/ solution (100ml bottle),syrup, lorazepam (2 mg),tablet, magnesium sulphate injection (50 % w/v 10ml amp),injection, medroxyprogesterone acetate (injection 150 mg 1ml/vial),injection, moxifloxacin ( 400mg),tablet, nepafenac(1mg/ml),eye drop, nicotine (nrt) (2 mg chewing gum ),gum, nicotine (nrt) (4 mg chewing gum ),gum, pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg(tab)(tablet (with additional content acceptable)),tablet, phenobarbitone (200 mg/ml),injection, potassium chloride 150mg/ml injection, 10ml ampoule (10ml ampoule),injection, pregabalin (75mg),capsule, rabeprazole + levosulpiride (20mg +75mg),tablet or capsule, rifaximin (400mg),tablet, sitagliptin (100mg),tablet, sitagliptin + metformin (50mg + 500mg),tablet, sodium hyaluronate (intraocular) (1% /ml),injection, sorafenib (200mg),tablet, tenecteplase (40mg),injection, tenecteplase 20mg (20mg),injection, teneligliptin (20mg),tablet, thyroxine sodium (75 mcg),tablet, tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg (pack of 180 to 200mdi),inhaler, tiotropium 9mcg 180 doses inhaler (180 or more doses acceptable),inhaler, tricholine citrate + sorbitol (550mg + 7.15 g/10ml ),syrup, vinblastine (10mg),injection, vitamin d3 (800iu/ml),drop, voglibose (0.2 mg),tablet, water for injection 5ml amp
 Loading, Please wait...

Connect us via What's Up