Tender For lab items - lab equipment s, binocular microscopes, portable water/soil kit, digital bod incubator, digital microscope with lcd screen and built in camera microscope , microscope inbuilt camera, digital haemoglobinometer (hbmeter), trinocular microscopes, autoclave, deep freezers 100 ltr, trinocular microscopes, water analyzer with colorimeter, d.o. meter, conductivity, tds, ph, salinity and temperature, autoclave, activity tds ph and temperature (water analyzer with colorimeter, d.o. meter, conductivity, tds, ph, salinity and temperature ), digital thermal cycler pcr, dissolved oxygen meter, cod analyzer with digestor, flame photometer, semi-automatic microtome, interactive uhd led board, distilling apparatus condenser, semi-automatic immunoassay analyser, electronic micro balance, viscocity meter bath, digital flame photometer with solution and compressor, digital potentiometer, ultrasonic interferometer, uv visible spectrophotometer, phase contrast microscope, hot air oven universal, water bath rectangular single walled, heating mantle, bunson burnars, buret stand, hot plate magnetic stirrer, double stage vacuum pump, digital flame photometer dual channel, columns for columns chromatography, polarimeter, digital abbe refractometer, ftir spectrometer this instrument is operated by a pc with user friendly software and a comprehensive manual, mixer / grinder, blotting paper, ganongs potometer, farmer s potometer, ganong light screen, ganongs respirometer, wilmots bubler appratus, arthron reagent, micropipet, acetone gas jar, farmerse photometer, stage micrometor, gas cylinder, 5 liter copper ghada, freeze /doubal door (230 lit), bm slide cabinate (capacity2000 slides size 15x18x3, cooling centrifuge, scepter cell counter, spectrophotometer, microtome rotary, bacterial colony count, tlc apparatus, osmotic pressure apparatus, seed germinattor, humidity & temperature control cabinet, plant growth, tissue culture rack, function generator, dual trace cro, study of elastic constant, susceptibility measurements, study o frank and hertz experiment, study of calcite prism, four probe methods, fourier analysis, oscilltors, study of ac oustical and optical modes, di electric constant, pn junction diode, e/m by thomsons method, study of solar cell, e/m by zeeman effect, hall effect, newtons ring app, rydbergs constant, gm counter, michelson interferometer, febry parot interferometer, rocks, minerals and fossils showcase almirah with glass, satellite imagery, gps wireless pocket receiver for survey or geologist, projector, fossils, fossils, micro scope ( petrological polarized microscope), 3d models ( structural geology), geological brunton compass with black lather case compass (black), digital camera, thin section of rocks slide, thin section of minerals slide, resistivity meter, slide film projector, india/asia/mp /world map physical and political, (tracing table with stand), (plumb bomb), prismatic compass, tripod stand, tape 50m, plain table tripod stand steel,sampatal wood set, simple aluminum alloy and fork, trough compas, engineering chain 100 feet, classical globe, theodo light complete set (tripath stand steel, reading scale, solar system automatic, french curve, natural map of the world in hindi 3d with frame, world political map in hindi 3d with frame, physical map of india in hindi 3d with frame, political map of india hindi 3d with frame, natural map of madhya pradesh in hindi 3d with frame, political map of madhya pradesh in hindi 3d with frame, sanitary vending machine, water cooler with ro
Tender For retender for supply of botany lab equipment - procurement of botany lab equipment, modular laboratory workstation (with sink, switches) specification steel/ iron made, total size 500sq feet, real time electrophoresis system, with power supply specificationvertical slab gel system polyacrylamide gel, craft s micro imaging system specificationimported camera eyepiece with computer or laptop connectivity with usb port, entomological dissecting microscope specificationlens 83 mm dia. eye-pieces 10x and 20x, donna- pattal making machine specificationfully automatic double die crank machine, raw material banana leaf, palash leaf, etc, 220v, 1hp motor, mild steel , imported e-learn interactive white boards specification75 inches 4k uhd touch screen led tv ultratouch display interactive flat panel monitor(3840 x 2160 pixels) , horizontal laminar flow specification4 2 2 (stainless steel body) 90 lt./per hepais 90 + 20 fpm noise level in very low, working fluorescent light, pcr teaching kit specificationtest efficient and easy to use, colony counter specification4 digit, microlit micropipette specificationmultichannel 8 channel fully auto removable, dahl digestion unit specificatonaluminium heating block and fumes extraction system, digestion of plant, soil sludge, food grams, processing 100 ml tubes, leaf area meter specificationfully automatic, portable water/soil kit specificationph mv conductivity, tds salinity, turbidity, d.o. and temp., magnetic stirrer with hot plate specification2 liters capacity, water bath rectangular specification16" 12" 4" 12 holes of 3" diameter, seed germinator specificationsingle chamber, suitable for conducting experiments on variety of seeds under different conditions of temp. and humidity. inner size 555 910 605 mm s.s. interior having 6 nos. adjustable shelves. tabular heaters are fitted. windowed front glass door outer inner full view acrylic door enabling to keep temp. and humidity level un-interrupted. full feature digital temp. controller cum indicator with voltmeter stainless steel with 14 trays., tissue culture rack specificationfitted with switches and 0-24 hrs. timer made of mild steel duly painted. rack size 48 21 (depth) is covered with thick ubreakableplexi-glass. each rack fitted with 4 fluorescent tubes and four bulbs. it is a unit with four shelf. each shelf with one u.v. tube for sterilization purpose., electronic balances digital specificationkea-210 200 gm 0.001 gm (1 mg) 80 mm , laboratory bod incubator specification12 cu.ft. 900 650 550mm s.s inner capacity 340 liter, fully automatic fume hood specification1500x750x2100mm, universal phase contrast cum dark field/bright field binocular research microscope specificationequipped with double slidder unit and condenser system which enables bright field, dark ground and phase contrast observation by a simple change over procedure. this microscope is designed latest phase techniques for most convenient observation of all colourless and transparent specimens and living bacteria etc. wihout staining. provides excellent contrast and a perfect flat image. coarse motion with universal locking device and highly sensitive fine focusing reading to 0.002 mm. supplied with imported slider phase contrast cum dark field equipment having phase annuls with abbe condenser and set of phase plates and provision for accurate centering. supplied with din standard optics, fluorescence microscope (imported-flurex) specificationepi-fluorescence arm with butyl in two/four (option) filters (uv, v, b, g) dichoric mirror and barrier filters. wf 10x/fov 20 mm (paired). objective plain achromatic objective 4x, 10x, 40x, 100x. fluorescence objective 4x, 10x, 40x, 100x. standard interference filters 1. b excitation (400-490 nm); 2. g excitation (510-550 nm). optional 1. uv excitation (300-400 nm); 2. v excitation (395-415 nm). transmitted tungsten halogen lamp. fluorescent sources 100 w mercury lamp. complete with instruction manual
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76