Latest reagent chemical Tenders | Government reagent chemical Tenders

State Government

CTN :39863752

04 Apr, 2025 15.00 Lacs

Hindaun - Rajasthan

Tender For supply of lab & reagent- ldh test kit, amylase test kit, haemoglobinometer isi mark, haemoglobin pipette isi mark, rbc pipette isi mark, neubers chamber isi mark, esr tube disposal with pipette cap, cbc printer paper, auto analyzer paper role, urine container, test tube stand 36 tube(plastic), dlc counter, sulfur powder, test tube holder, abx diluent horiba, abx lyse horiba, abx cleaner- horiba, abx mino clearer horiba, ckmb test kit, ck nac test kit, serum albumin test kit, d.t.a. tube k-3 double cap, dengue nsi + igg +igm (rapid), malaria (antigen) (rapid), urine analizer (strip), digital hb meter strip hb 301 (hemocue), blue tipes 1000 ul, yellow tipes 200ul, coombes test (direct), coombes test (indirect), promthrombin testkit, seman analysis sierm count, serum hdl, serum ldl, serum trigly ceride, sodium citrate 3.8%, acetic acid, n/10 solution, nitic acid, urostick(aib & sugger), blood sugger kit(for semiautoanalizer), blood urea kit (for semiautoanalizer), serum cretinine kit (for semiautoanalizer), serum total cholostol kit(for semiautoanalizer), serum bilirubin (for semiautoanalizer), s.g.o.t. (for semiautoanalizer), s.g.p.t. (for semiautoanalizer), alkine phosp. (for semiautoanalizer), uric acid (for semiautoanalizer), anti sera a,b,d, 10ml, lactin a kit (rapid), coombs test (rapid), v.d.r.l.(rapid), widal test (slide method), r.a. factor (rapid), austrilan antigen kit(rapid), h.i.v. test kit(rapid), m.t. vail 10 tu, e.d.t.a. power, lieshmans stain, a.s.l.o. kit(rapid), c.r.p. kit, pregnancy kit card, disttil water, micro clear glass slide(76*26*0.95) with ground polish edge (isi marked), dropper bottel, hb tube(isi marked), tlc pipetts(isi marked), test tube 10(isi marked), test tube 3(isi marked) glass, capilary tube(isi marked), p.t. tube (isi marked), filter paper/blooting paper, chamber cover slip, hbs ag(rapid method kit), dengue kit(elisa method kit) ns1, s. calcium, triglyceride, lenset(plastic), multisticks(for urine), platelet counting fluid(rees ecker), tec fluid, trbc fluid, wbc fluid, malariafild stain a, stain b, glucometer, glucometer strip, plain vial 3 inch with double cap, torniquit, s.vldl kit, disposal syring 2ml/5ml, needle disposal, s.floride vial with cap, stool test kit, sodium citrate vial 3.8% with cap, diluent adonis, lyse diff. solution adonis, detergent cleaner adonis, probe cleaner concentrate adonis, fluid pack na/k/cl, daily cleaning solution, electrolyte control trilevel, printer paper for electrolyte, coombs sera (ahg), albumin sera (bovine serum), vtm for swine flue, methanol, field stain a, field stain b, a.h.g., supravital stain/new methylene blue, tissue paper, immersion oil, 10% buffered formalin, acetic acid, anti a for blood group, anti b for blood group, anti d for blood group, ppe kit, mask 3 layer, mask simple, mask k 90, chickin guniya kit (rapid), scurbtifus kit (rapid), sodium hypochlorite, bleeching powder, liquid soap for hand wash, z-5 dn( diluent) zybio, z5 ld (lyse) zybio, z5 lb (lyse) zybio, liss card /coombs (ahg) bio-rad, blood case group (diac lan abo/d reverse grouping (bio-rad), alat fs, asat fs, albumin fs, alkaline phosphatase fs, bilrubin auto direct fs, bilrubin auto total fs, calcium as, cholestrol fs, ck mb fs, ck nac fs, creatinine fs, crp fs, glucose god fs, hdl c direct fs, ldh 21 fs, total protein fs, rhematoid factor fs, triglyceride fs, urea fs, uric acid fs, tru cal crp, tru cal lipid, tru cal u (universal), trulab n, sys alkaline cleaner, sys antibact cleaner, z-5 diluent, z-5 lb lyse, z-5 ld lyse, z-5 cleaner, lyse 5 part (adonis), detergent 5 part (adonis), detergent sheath 5 part (adonis), diluent 5 part (adonis), sensa core abg reagent pack, hitachi sample cup, ldl-c direct fs, amylase fs, micro vial, vocutainer needle, vocutainer holder, vacutainer vial edta k-3, vacutainer vial plain, vacutainer vial sodium floride, semi auto analyzer, prothrobintime test machine, micro pipatte (5 -50ul), micro pipatte (10-100ul), micro pipatte

State Government

CTN :39876187

07 Apr, 2025 9.50 Lacs

Jaisalmer - Rajasthan

Tender For mnjy lab & blood bank rezents items purchase tendar-, , , glucose , , urea , , creatinine enzymatic , , billirubin total , , billirubin direct , , sgot-el , , sgpt-el (all) , , alkaline phosphatase , , total protein , , albumin , , calcium , , ck-nac , , ck-mb , , ldh , , amylase , , uric acid , , total cholesterol , , triglyseride , , hdl cholesterol with cal , , ldl cholesterol with cali , , four norn , , erba path , , erba path , , xl-multical , , xl-autowase ac/al kit , , lipase xl , , glucose , , urea , , creatinine , , billirubin total , , billirubin direct , , sgot , , sgpt , , alkaline phosphatase , , total protein , , albumin , , calcium , , ck-nac , , ck-mb , ldh , , amylase , , uric acid , , total cholesterol , , triglyseride , , crp test , , aso-title , , ra factor , , vdrl strip , , hbsag card , , hcv tri-dot , , hiv tri-dot , , dengue (igm, igl, ns1) , , combo pack , , mp card , , dengue elisa - igm , , dengue elisa - igi , , dengue elisa - ns1 , , widal , , hemoglobin tube (round) , , hemoglobin tube (squire) , , tlc pipettes , , liqueur anmonia , , n/10 hcl , , j.s.b. stain i , , j.s.b. stain ii , , benzidine gr 5 gram , , hydrogen peroxide , , glacial acctic acid , , sodium nitro prusside , , ammonium sulphate , , tipol solu/labopol , , sulphur powder , , sulphric acid , , barium chloride solu. , , fouchets reagent , , ehrlich's reagent , , cone. hno3(nitric) acid , , total eosinophil count fl , , eosin powder , , methanol , , xylene , , sulphosalicylic acid 30% , , cover slip , , centrifugal test tubes , , glucometer strip , , tlc fluid , , giemsa stain , , leishman powder , , benediect solu. , , tincture iodine 5% , , liquid paraffin , , sodium citrate 3.8% , , gram stain , , semen diluting fluid , , leishman stain , , uristix , , anti a , , anti b , , anti d , , dispo. syringe 10 cc , , dispo. syringe 5 cc , , disposyringe 3 cc , , dispo. syringe 2 cc , , dispo. needle no 22 , , dispo. needle no 23 , , dispo. needle no 24 , , cottan roll , , sprit , , edta k3 tubes , , plain tube , , dispo, gloves 6.0 , , dispo, gloves 6.5 , , dispo. gloves 7.0 , , dispo. gloves 7.5 , , borosil glass test tube , , pregnancy test card , , n-95 mask , , filter paper , , neubaur's chamber , , sahlis's heamoglobinomet , , capillary tube , , dropper , , dispo.tips (yellow) , , dispo.tips (blue) , , microscope lence 100x , , microscope lence 45x , , microscope lence 10x , , microscope bulbs (6v20w) , , room thermomter , , lancet disposal , , d-water , , tissue paper , , glass slide , , esr tube , , paper roll 210mmx20mtr , , hiteshi cup , , hiv elisa , , hepatitis b elisa , , hepatitis c elisa , , hiv tri dot , , hepatitis b , , hcv tri dot , , vdrl strip , , single cpda blood bags , , double cpda blood bags , , triple cpda blood bags , , double sagm blood bags , , triple sagm blood bags , , anti ab , , anti human globulin , , 22% bovine albumin , , anti a1 , , instead of h , , wafers , , id-diluent 2 , , liss/coombs , , round bandaid , , anti abd combo pack , , dispo exam gloves , , urine contain , , hb strip hemo cuvet , , tourniquet , , hb pipet , , dispo mask three lyer , , ppe kit , , urostix , , vtm , , sanitizer , , micro cuvette , , filed stain a , , filed stain b , , wbc pipet , , gram stain , , multi stric , , transfer blood bag , , copper sulphate , , hypo chloraied ,

CTN :39852997

15 Apr, 2025 56.23 Lacs

Palghar - Maharashtra

Tender For medicine and surgical item purchase at hup - description, cap. vitamin d3 60k, cap. nifedipine 10mg, clobetasol + miconazole + neomycin ointment, diclofenac gel 1% 30mg, diclofenac spray, tab. aspirin 150mg, lignocaine 2% gel 30gm, tab. atorvastatin 10mg, betadine ointment 25gm, pcm drops 100mg/ml (15ml), syrup antacid (magnesium hydroxide), syrup cough expectorant, tab. amoxycillin + potassium calvanuate 625mg, tab. vitamin c 500mg, tab. azithromycin 500mg, tab. calcium lactate, tab. levocetirizine 5mg + montelukast 10mg, tab. cefixime 200mg, tab. diclofenac 50mg + paracetamol 500mg, tab. ondansetron 4mg, tab. tranexamic acid 500mg, tab. mvbc, tab. dicyclomine 10mg, ors powder 20.5gm packet, inj. diclofenac 1cc, inj. dexamethasone 2cc, inj. soda-bi-carb, inj. furosemide 10mg, inj. tramadol, inj. lignocaine 2%, inj. pheniramine 22.75mg, inj. pcm 175mg, inj. atropine, inj. busco pan, inj. ondansetron, inj. pantoprazole, inj. b complex, inj. cefotaxime, inj. ceftriaxone, inj. amoxycillin + potassium clavulanate 1.2gm, ns 100ml, ns 500ml, rl 500ml, dns 500ml, inj. hydrocortisone 100mg, water for injection, inj. mgso4, inj. iron sucrose 100mg, inj. metro 100ml, inj. vitamin k, tab. pantoprazole 40mg dsr, tab. aceclofenac + paracetamol, tab. albendazole 400mg, tab. fluconazole, tab. labetalol 100mg, neosporin powder, protein powder, inj. oxytocin, kmno4 crystals, i.v. 25% dextrose, inj. potassium chloride, inj. paracetamol infusion 1gm, syrup amoxycillin potassium clavulanate 250mg, syrup metronidazole 200mg, syrup ibuprofen 100mg, hydrogen peroxide 250ml bottle, inj. lignocaine with adrenaline yl, inj. xylocaine 2% pack of 24, dynaplast roll, 3-layer mask, mucus extractor, needle no.24, pediatric oxygen mask, proctolysis enema, antiseptic liquid (chlorhexidine gluconate) 500ml, sticking plaster, suction catheter, syringe with needle 2ml, syringe with needle 5ml, syringe with needle 10ml, syringe with needle 20ml + 50ml, syringe with needle 50ml, hydrogen peroxide and silver nitrate solution for fumigation 5 litres, distilled water 5 litres, doppler ultrasound gel 250ml, biomedical waste bag red color 1kg, biomedical waste bag black color 1kg, sodium hypochlorite 5 litres, scalp vein no.22 black color, i.v. set leur slip vented, iso propyl alcohol (medical spirit) 5litre, mackintosh sheet 3*6feet, cord clamp, foleys catheter no. 14, foleys catheter no. 16, urine bag, sticking tape, white bed sheets 90*60 inch, solapuri blanket 90*60 inch, baby blanket 100*80cm, draw sheet (cotton) width: 90-110cm, length: 150-180cm., turkish towel 40*60 inch, napkin 14*21 inch, washable pillow 28*17 inch, pillow cover 30*20 inch, mattress with rexin cover (waterproof mattress cover) 40*80 inch, baby wrapper 26*28 inch, cotton plain towel (green color), dynaplast easyfix for cannula fixation, foleys catheter no. 18, plain blood collection tube, edta blood collection tube, fluoride blood collection tube, sterile lancets accu chek safe t pro uno, blood collecting needle, urine strips (albumin / sugar), sickle cell anemia rapid test kit, gluco check (blood glucose test strips), electrolyte reagent (el-120), thermal paper roll 80mm*50mtr, agd 300 cbc analyser kit (autodil plus, autolyse plus, soak solution, thermal paper roll 57mm*40mtr), yellow tips, hbsag kit, vdrl kit, blood group kit, micro slide, forcep 6 inch ss, tissue paper roll, abdominal wall retractor, sponge holding forceps, doyen s retractor, deauer s retractor, allis forceps, towel clips, bab cock forceps, scissors tissue cutting, cheatle forceps, artery forceps, straight curve forceps, mosquito forceps curve, green armytage forceps, morris retractor 2 x3 x9 , self-retaining retractor, uterine holding forceps, sims speculum, vulsellum, uterine sound, gawn surgical, scrub suit, surgical cap, hole towel, drawsheet, green towel big, green towel small, bedsheet, blanket, doctor coat, washable plastic apron, rexine pillow, rexine apron, rexine mattress, patient dress (back dori), patient dress,

CTN :39853630

07 Apr, 2025 NA

Kannur - Kerala

Tender For purchase of lab,blood bank reagents and other consumables at district hospital kannur - purchase of lab,bloodbank reagents & other consumables for 2025-2026, ammonium sulphate (500 gm), barium cloride 10% (500 ml), benedicts reagent (500 ml), blood lancet, brush for microscope, brush small, clot activator tube (5ml), dengue 1gg/1gm card test, dengue ns1ag card test, disposable esr pipette, whatman filter paper,circle, fouchets reagent (125 ml), geimsa stain (500 ml), glucose +ketone bodies urine strip, glucose + protein urine strip, hbsag card test, hcg (upt) card test, hcv card test, heam test (occutt blood), heparin tube, hitachi cup, k3 edta tube (5ml), labo clean (5ml), leishman stain (500 ml), leptospira card test, liquid paraffin (500 ml), liquor ammonia (500 ml), microscopic cover slip, micro pipett fixed volume, micro pipett variable volume, micro slides, ph paper, sodium citrate esr tube, sodium citrate bottle3.8% (2 ml), sodium flouride coated bottle, sodium nitroprusside (100 gm), syringe 1 ml, test tube -glass (12 x 100mm), bullet vial - plastic, urine centrifuge tube- glass, urine sample container, urine sample container (sets sterile), vdrl (syphillis) card test, white tip (small) -5-20 micro ltr, yellow tip - 20-200 micro ltr, blue tip, widal slide test kit, round plaster, matrix gel card- 144t, liss solution ( 25 x 250ml), micro tips,1.5 ml, rpr card, anti d, blend (10 ml), anti d, igm (10 ml), anti a (10 ml), anti a1, lectin (10 ml), anti b,10 ml, anti d,igg 10 ml, anti h lectin, malaria card, hiv elisa test kit-96t, hbsag elisa kit (j .mithra)- 96t, hcv elisa kit (tulip)-96t- 96t, filter paper sheets, skin stapler (steel), disposable surgery kit, bd spiral needle no.25, bd spiral needle no.27, disposable syringe with needle 5ml, disposable syringe with needle 2 ml, et tube no.7, et tube no.7.5, dyna plast, ecg electrodes, top o plast (1mtr), ringer lactate ivf (500 ml) glass bottle, ecg paper- bpl 9108 d-z fold -210 x 140 x 140-12 channel (original with 80gsm), ecg paper- bpl 9108 -z fold a4 -12 channel(original with 80gsm), ecg paper- bpl 6108t-single channel (original with 80gsm), ecg paper- bpl 6208 view -80 x 20 mtr- 3 channel(original- 80gsm), ecg paper rolled 210- 12 channel, ctg paper, tmt paper(schiller), ecg gel- 250 ml, bpl limb electrodes clip (04 nos/box), bpl chest electrodes (06 nos/box), swab stick (sterile tube), ortho- phthalaldehyde solution -5ltr can, tourniquet, liquid detergent, rpr test kit, plastic test tubes(riya tubes)(100 nos pkt), sulphosalycylic acid-500 ml btl, sulpher powder-pkt, isopropyl alcohol-500 ml btl, aso test kit, whatman no.1 filter paper, x ray ( computerised radio graphy- model a), fuji film (18 cm x 24 cm) or ( 8" x 10"), fuji image plate (18 cm x 24 cm) or ( 8" x 10"), fuji cassette (18 cm x 24 cm) or ( 8" x 10")

State Government

CTN :39862487

04 Apr, 2025 35.00 Lacs

Adimaly - Kerala

Tender For supply of lab reagents thq - heamatology analyser 3000 mindray, diluent 20l, rinse 20l, lyse 500 ml, ez cleaner 50 ml, probe cleaner 50 ml, heamatology analyser 6000 mindray, ds diluent 20 l, m6lh lyse, m6ln lyse, m6ld lyse, m6fn dye, m6fd dye, probe cleanser, leishmans stain, lancet, vesmatic 20 esr machine, vaccutech tubes, qualcyle 10 esr machine, esr tubes, mispa i2 ( 2 machines), crp, hba1c, d dimer, trop t- rosche cobash, trop t- rosche cobash, electrolyle ckk lyle (na+ k+) pack, daily cleaner, qc, urine analysis, urine strip (g&k) acctone, urine strip (g&p), upt cards, sulphosalicylic acid solution 3%, sulpher power, barium chloride 10% solution, fouchets reagent, filler paper (dr.watts) no 1, microscopic glass slide, cover slip (18*18mm), ria vials, glass test tube 15*125 mm, blood grouping sera a,b,d, n/10 hcl, biochemistry analyser, ra, aso, hbsag, hcv, dengu ns1, dengu igm, igm leptospirosis card test, carbogen rpr test kit, widal card, glucose reagent for semi auto biochemistry analyser, fully automatic biochemistry analyser, glucose, cholesterol, tgl, hdl, urea, creatinine, uric acid, bilirubin total & direct, sgot, sgpt, total protein, albumin, alkaline phosphate, qc norm for bs 390 biochemistry analyser, qc path for bs 390 biochemistry analyser, multy calibrator, amylase, lipase, calcium, phopherus, alkaline washing solution, hormonal test, tsh, t3, t4, free t3, free t4, feritin, transferrin saturation, iron, consumables, k3 edta tube, clot activator tube, heparine tube, urine container, scew capped sample vial, hitachi cup, blue tip, yellow tip, bullet vial, ria vials, reagents for pt inr test (erba), reagents for aptt test (erba), internal qc for heamatology bc 6000 analyser

CTN :39844020

17 Apr, 2025 NA

Multi City - Andhra Pradesh

Tender For supply of merck make reagent chemicals

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Reagent Chemical Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

State Government

Central Government/Public Sector

Central Government/Public Sector