Latest reflective tape Tenders | Government reflective tape Tenders

CTN :39849256

16 Apr, 2025 NA

Izatnagar - Uttar Pradesh

Tender For supply of retro reflective tape (size-50mm width x 25 mtr. length minimum), colour-yellow, quality- grade-1, type- pressure bonding (r1-p) conforming to is 14221 : 1995 (reaffirmed 2021).

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

CTN :39827820

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials in hulical town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39827891

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials - public health materials, bleaching powder(p/h), bleaching powder(w/s), white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, lyzol floor cleaner disinfectant, sodium hypochlorite solution, mask, emi stock solution, soap oil, (harvicide), fogging gas cylinder, rubber glouse, cotton gloves, rain coat(male & female), life jacket with reflector, helmet, gum boot, plastic basin, 50 lit syntax backet, white lime powder, , ( ), ( ), ( ), , ( ), ( ), ( ), ( ), , , , , 80 lit syntax bucket, 4 pin hook with pipe handle (sumal), 4 pin hook with pipe handle (big), grass knife, hand sanitizer, sprayers(12 liters capacity), sprayers(16 liters capacity), plastic koodai(sumall), syntex bucket (50 lit), syntex bucket (70 lit), plastic koodai(big), 24 mm crowbar, 25mm crowbar, shawel, water testing kit

CTN :39793885

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials at naduvattam town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39794075

28 Mar, 2025 50.00 Lacs

Nilgiris - Tamil Nadu

Tender For ovtp supply of public health materials - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39809138

28 Mar, 2025 10.00 Lacs

Nilgiris - Tamil Nadu

Tender For supply of public health materials in sholur first grade town panchayat 2025-2026 - bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39816336

15 Apr, 2025 NA

Kargil - Jammu And Kashmir

Tender For supply of solar edge indicatior , gantry sign board 12 , cantilever sign board 6 , mile stone retro reflective sign board , cautionary sign retro refletive tape right hand , cautionary sign retro reflective tape left hand , cautionary sign retro reflective tape go slow , cautionary sign retro reflective tape speed limit , double chevron sign board , cautionary sign retro reflective tape compulsory sound horn , chevron sign retro refelctive tape , road delineator , solar road stud , informatory signage bothside retro reflective tape , gurdrail reflector yellow , gurdrail reflector white , led vms , testing and installation of vms

Central Government / Public Sector

CTN :39809503

14 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of plumbing items - 1.5 inches cpvc pipes , 1.5 inches cpvc in-trhread brass coupling , 1.5 inches cpvc elbow , 1.5 inches cpvc couplings , 1.5 inches cpvc ball value , 1.5 inches cpvc unions , 1.5 inches upvc t junction , 1.5 inches upvc unions , 1 inches cpvc ball value , 1 inches cpvc tank nipple , 1 inches cpvc in-thread brass , 2 inches x 1 inches cpvc reducer - 2 1e , ashirvad 118 gum solution , teflon tape , hexa blade , 1.5 inches g.i. clamps , 2.5 inches nails , 1.5 inches upvc out-thread couplings , 2 inches pipe , 2 inches elbow , 2 inches couppling , 2 inches mabt , 2 inches fabt , 2 inches union , solution

Reflective Tape Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector