Latest resin powder Tenders | Government resin powder Tenders

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

CTN :39846661

17 Apr, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of dglp re 26 - tips saliva ejector disposable pack of 100 , wire ss round hard 0 point 6 mm coil of 500 gm , pedodontic diamond burs , calcium hydroxide coated gp points , base comma acrylic resin powder pink shade bott of 450 gm and acrylic resin liquid bott of 227 point 3 ml , base comma acrylic resin powder clear shade bott of 450 gm and acrylic resin liquid bott of 227 point 3 ml , box denture and appliances , burs diamond for grinding metal for shp assorted set with component enlisted as , crown and bridge metal np alloy for box of 1 kg , crown and bridge separating liquid bott of 100 ml , cutter carbide pointed for straight hand piece , cutter carbide flat for straight hand piece , zinc phosphate cement powder 90 to 100 gm comma liquid 35 to 40 ml , teeth acrylic cross linked set of 28 complete comprising one set each of upper and lower anterior teeth and one set each of upper and lower posterior teeth , teeth anterior acrylic cross linked lower set of 6 , teeth anterior acrylic cross linked upper set of 6 , teeth posterior cross linked acrylic set of 16 upper and lower bid number/ & ( * ) : gem/2025/b/6082494 dated/ + : 27-03-2025 bid document/ 3 3 1 / 18

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39796680

26 Mar, 2025 NA

Burdwan - West Bengal

Tender For supply of gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade , gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39222391

28 Mar, 2025 NA

Pune - Maharashtra

Tender For bid to ras supply of chemicals for preparaion of green primary explosives - 5 aminotetrazole monohydrate purity greater than 98 percent pack of 100 g as per qap no hemrl meg gpe rm 001 , copper ii sulfate pentahydrate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 002 , sulfuric acid purity greater than pack of 2 point 5 lit as per qap no hemrl meg gpe rm 004 , celite 545 purified calcined , ph equal to tilde 8 pack of 1 kg as per qap no hemrl meg gpe rm 005 , copper i chloride reagent plus purified purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 006 , 3 bromoanisole purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 007 , aminoguanidinium bvicarbonate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 008 , ammonium acetate acs reagent purity greater than 97 percent pack of 500 g as per qap no hemrl meg gpe rm 009 , silver nitrate acs reagent purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 010 , ammonium iron iii sulfate dodecahydrate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 011 , ammonium thiocyanate acs reagent purity greater than 97 point 5 percent pack of 500 g as per qap no hemrl meg gpe rm 012 , 1 butanol acs reagent purity greater than 99 percent pack of 500 ml as pe qap no hemrl meg gpe rm 013 , glacial acetic acid acs reagent purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl meg gpe rm 014 , potassium dichromate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 015 , sodium hydroxide purity greater than 98 percent pack of 500 g as per qap no hemrl qap naoh 2024 317 , acetone purity greater than 99 point 5 percent pack of 2 point 5 lit as per qap no hemrl qap rm acetone 2023 52 , isopropyl alcohol purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl qap rm ipa 2023 43 , potassium hydroxide purity greater than 85 percent pack of 500 g as per qap no hemrl qap koh 2024 319 , sodium azide purity greater than 99 percent pack of 500 g as per qap no hemrl qap sodium azide 2024 360 , nitric acid purity greater than 70 percent pack of 2 point 5 lit as per qap no hemrl qap rm nitric acid 2023 54 , sodium nitrite purity greater than 96 percent pack of 500 g as per qap no hemrl meg gpe rm 003

Central Government And Public Sector

CTN :39540988

03 Apr, 2025 21.5 Thousand

Karwar - Karnataka

Tender For corrigendum : supply of chemicals to krims, karwar - ethyl alcohol 500ml for biochemistry (karwr), casien 500grm (karwr), sodium lauryl sulfate 500grm (karwr), methylmalonic acid 25grm (karwr), oxaloacetic acid 5grm (karwr), amido black 10b 100grm (karwr), p- dimethyl benzaldehyde 500grm (karwr), cholesterol 100grm (karwr), four-nitroaniline 250grm (karwr), demthyl amine 500ml (karwr), dimethyl sulphoxide 500ml (karwr), magnesium chloride 500grm (karwr), sodium salicylate 500grm (karwr), phosphotungustic acid 100grm (karwr), o-cresolphthlein complexone 5grm (karwr), succinic acid 500grm (karwr), eight-hydroxy quinoline 100grm (karwr), buffer capsule (karwr), brij (30 percent) 500ml (karwr), one-nitroso-2napthol 25grm (karwr), bromophenol blue 25grm (karwr), agarose medium 25grm (karwr), potassium dihydrogen orthophoshate 500grm (karwr), sodium chloride 500grm (karwr), di- acetyl monoxime 100grm (karwr), uric acid 100grm (karwr), creatinine 100grm (karwr), calcium chloride 500grm (karwr), lead oxide 500grm (karwr), cupric acetate 500grm (karwr), sulphur powder 500grm (karwr), conc .hydrochloric acid 5litrre (karwr), conc sulphuric acid 5litrre (karwr), conc.nitric acid 2.5litre (karwr), trichloro acetic acid 500grm (karwr), tris buffer 500grm (karwr), picric acid 500grm (karwr), thiosemicarbazide 500grm (karwr), tartaric acid 500grm (karwr), sulphosalycilic acid 500grm (karwr), starch 500grm (karwr), sodium dihydrogen orthophosphate 500grm (karwr), sodium pyuruvate 25grm (karwr), sucrose 500grm (karwr), sodium acetate 500grm (karwr), sodium tungustate dihydrate 100grm (karwr), resorcinol 500grm (karwr), phenyl phosphate disodium salt 25grm (karwr), potassium ferricynide 500grm (karwr), potassium sodium tartarate 500grm (karwr), potassium dichromate 500grm (karwr), phenyl hydrazine hydrochloride 500grm (karwr), pottasiun iodide 250gr (karwr), peptone 500grm (karwr), phenol crystals 500grm (karwr), oxalic acid 500grm (karwr), napthol 100grm (karwr), ninhydrine 100grm (karwr), methyl red solution 125ml (karwr), mercuric sulphate 250grm (karwr), molybdic acid 100grm (karwr), magnesium sulphate 500grm (karwr), maltose 500grm (karwr), metol 500grm (karwr), l-alanine 500grm (karwr), l-aspartic acid 100grm (karwr), leadacetate (anhydrous) 500grm (karwr), lactose 500grm (karwr), gelatin powder 500grm (karwr), ferric chloride anhydrous 500ml (karwr), formaldehyde 500ml (karwr), ethylene diamine tetraacetic acid 100grm (karwr), dipottasium oxalate 500grm (karwr), diphenyl amine 100grm (karwr), d- ribose 25grm (karwr), dexrose 500grm (karwr), dinitro phenyl hydrazine 500grm (karwr), d-fructose 500grm (karwr), calcium carbonate 500grm (karwr), coumasssie brilliant blue 25grm (karwr), chromatograph sheets 25units (karwr), chloroform 2.5litre (karwr), butanol 500ml (karwr), bromocresol green 100grm (karwr), barium chloride 500grm (karwr), amino acid kits (24nitem) 2box (karwr), iso-amyl alcohol 500ml (karwr), acetic anhydrous 500ml (karwr), alpha-keto glutaric 25grm (karwr), four-amino antipyrine 100grm (karwr), l-ascorbic acid 500grm (karwr), ammonium persulphate 500grm (karwr), one amino, 2-napthol,4-sulphonic acid 100grm (karwr), maglumi trop-i (karwr), maglumi ck-mb (karwr), fully automated analyser (xl) amylase 5x11ml (karwr), fully automated analyser (xl) d-dimer control( r1-5x1ml, r2- 5x1ml) (karwr), fully automated analyser (xl) ferritin control(1x1ml) (karwr), fully automated analyser (xl) crp control (1x1ml) (karwr), fully automated analyser (xl) ferritin with calibrator (r1- 2x14.5ml ), r2- 2x7.7ml (karwr), fully automated analyser (xl) d-dimer with calibrator( r2-1x4 ml) (karwr), sodium bisulphate 500gm (karwr), benzidine reagent 500ml (karwr), nitric acid 2.5l (karwr), acetone 2.5 l (karwr), sodium sulphite 500gm (karwr), sodium hypobromite 500ml (karwr), silver nitrate 500gm (karwr), sodium bisulphite 500gm (karwr), sodium hydroxide pellets 5 kg (karwr), sodium carbonate 500gm (karwr), glacial acitic acid 500ml (karwr), iodine 1

Central Government/Public Sector

CTN :39671240

02 Apr, 2025 NA

Jabalpur - Madhya Pradesh

Tender For supply of chemicals make hi media , potassium hydroxide, pct1560-500g , potassium chloride, pct0012-500g , barium chloride dihydrate, mb335-500g , calcium chloride dihydrate, pct0004-500g , calcium carbonate, pct1528-500g, , tri-calcium orthophosphate, grm1277-500g , di-potassium hydrogen phosphate anhydrous, grm168-500g, , potassium dihydrogen phosphate, pct0009-500g , magnesium sulfate heptahydrate, tc577-500g , sodium chloride, hi-artm/acs, grm3954-500g , ammonium chloride, pct0123-500g , sodium succinate hexahydrate dibasic, grm418-500g , dl-malic acid, free acid, grm203-500g , citric acid anhydrous, pct0501-500g , d-mannitol, pct0604-500g , d-(+)-glucose anhydrous, pct0603-500g

State Government

CTN :39605962

28 Mar, 2025 NA

Lucknow - Uttar Pradesh

Tender For tender for supply of chemicals - 2-thiobarbitric acid-ts500-5000 sigma , acetic acid-61784325001730-2.5l merck , acetocarmine, hi-ar grm4942-100ml himedia , acetone emplura-194500.2521-2.5 lit merck , aceto-grcain , agar powder, bacteriological-gr/mc26-500g himedia , agarose-mb004-100g himedia , agarose (low melting point) , alkali azide , ammonia buffer. , ammonia solution 25% emplura 500ml 1.93500.0521 merck , ammonium chloride-emplura-1.93621.0521 5006 merck , ammonium persulphate -mb003-500g himedia , ascorbic acid , benzene emplura 500 ml-1.01782.0521 merck , borax carmine 5003-125ml himedia , bromaphendi blue, practical gr.-grm914-256 hm , buffer for restriction enzymes , calcium choride dihydrate -1.93633.05.21 5006 merck , carnoy's fluid , centrifuge tube 2ml pr.500pc 500020 tarsons , claraform empluna 194506.0521-500ml merck , colchicine pct1302-16 himedia , coloured stacking gel buffer -m1208-200r himedia , copper (11) oxide grm732-500g himedia , copper (1) sulfate emplura -1.93616.0521 500g merck , d-glucose-1.94925,0521 500gm merck , dishes, culture, petri-3160072-80x17mm borosil , di-sodium hydrogen phosphate 1.93609.0521 5000 merck , dmso (dimethyl sulfoxide) , dfx mountant 250ml -61803502501730 marck , dulbecco's phosphate buffered saline edta (ethylenediaminetetraacetic acid) , eriochrome black t-25g. emparta 1.93320.0026 merck ethidium bromide , fehling's solution a 250 ml. 61779705001730 merck , falling solution b 250ml 61779705001730 merck ferrous sulphate grm1377-250gm himedia , fetal bovine serum (fbs) , fiter paper whatman-gr-1-125mm-1001-125-100/pk , folin & ciocalteu's -rm10822-250gm himedia , formaldehyde solution min. 37% emplura slii 1.94988.5021 march , forsted end slides bg003-10x50 no himedia , giama stain , glacial acetic acid 2.51 glycerol anhydrous emplura 1.94501.0521 500ml merck , glycine ar-154907.0521 500gm merck glycogen

Resin Powder Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector

State Government

Central Government And Public Sector

Central Government/Public Sector

State Government