Get complete information related to latest Resin Powder Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Resin Powder Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Resin Powder Tenders.
Tender For supply of dglp re 26 - tips saliva ejector disposable pack of 100 , wire ss round hard 0 point 6 mm coil of 500 gm , pedodontic diamond burs , calcium hydroxide coated gp points , base comma acrylic resinpowder pink shade bott of 450 gm and acrylic resin liquid bott of 227 point 3 ml , base comma acrylic resinpowder clear shade bott of 450 gm and acrylic resin liquid bott of 227 point 3 ml , box denture and appliances , burs diamond for grinding metal for shp assorted set with component enlisted as , crown and bridge metal np alloy for box of 1 kg , crown and bridge separating liquid bott of 100 ml , cutter carbide pointed for straight hand piece , cutter carbide flat for straight hand piece , zinc phosphate cement powder 90 to 100 gm comma liquid 35 to 40 ml , teeth acrylic cross linked set of 28 complete comprising one set each of upper and lower anterior teeth and one set each of upper and lower posterior teeth , teeth anterior acrylic cross linked lower set of 6 , teeth anterior acrylic cross linked upper set of 6 , teeth posterior cross linked acrylic set of 16 upper and lower bid number/ & ( * ) : gem/2025/b/6082494 dated/ + : 27-03-2025 bid document/ 3 3 1 / 18
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
Tender For bid to ras supply of chemicals for preparaion of green primary explosives - 5 aminotetrazole monohydrate purity greater than 98 percent pack of 100 g as per qap no hemrl meg gpe rm 001 , copper ii sulfate pentahydrate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 002 , sulfuric acid purity greater than pack of 2 point 5 lit as per qap no hemrl meg gpe rm 004 , celite 545 purified calcined , ph equal to tilde 8 pack of 1 kg as per qap no hemrl meg gpe rm 005 , copper i chloride reagent plus purified purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 006 , 3 bromoanisole purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 007 , aminoguanidinium bvicarbonate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 008 , ammonium acetate acs reagent purity greater than 97 percent pack of 500 g as per qap no hemrl meg gpe rm 009 , silver nitrate acs reagent purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 010 , ammonium iron iii sulfate dodecahydrate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 011 , ammonium thiocyanate acs reagent purity greater than 97 point 5 percent pack of 500 g as per qap no hemrl meg gpe rm 012 , 1 butanol acs reagent purity greater than 99 percent pack of 500 ml as pe qap no hemrl meg gpe rm 013 , glacial acetic acid acs reagent purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl meg gpe rm 014 , potassium dichromate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 015 , sodium hydroxide purity greater than 98 percent pack of 500 g as per qap no hemrl qap naoh 2024 317 , acetone purity greater than 99 point 5 percent pack of 2 point 5 lit as per qap no hemrl qap rm acetone 2023 52 , isopropyl alcohol purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl qap rm ipa 2023 43 , potassium hydroxide purity greater than 85 percent pack of 500 g as per qap no hemrl qap koh 2024 319 , sodium azide purity greater than 99 percent pack of 500 g as per qap no hemrl qap sodium azide 2024 360 , nitric acid purity greater than 70 percent pack of 2 point 5 lit as per qap no hemrl qap rm nitric acid 2023 54 , sodium nitrite purity greater than 96 percent pack of 500 g as per qap no hemrl meg gpe rm 003