Latest silica powder Tenders | Government silica powder Tenders

State Government

CTN :39841859

17 Apr, 2025 NA

Varanasi - Uttar Pradesh

Tender For supply of reagents and consumables for sanger sequencer model abi 3500xl - bigdye terminator v3.1 sequencing kit, 100 reaction, bigdye xterminator purification kit.100 preps, bigdye terminator v1.1,v3.15x sequencing buffer ,1ml, high capacity cdna reverse transcripastion kit with rnase inhibitor ,1000rxn, genescane 500 liz standrad 800 rxn, exosap-it clean up kit, 100 rxn, hidi formamide,5mlx4 pack, cathode buffer container, anode buffer container, multicapilliary ds33,8 runs, pop7,960 rxn, conditioning reagents, platinum superfi pcr master mix ,100 reaction, clonejet pcr kit, ro rxn, competent cells 10x100 ul, fix 7 perm medium a,100 ml, fix 7 perm medium b,100 ml, fluorescent primers,10000p moles, pop7,96 rxn, generuler dna ladder lo0bp s0ug fermantas, 6xloading dye solution r0611 mbi fermenta, microamp clear adhesive film, 100 pc, septa 96 well plate, microamp optical 96 wells reaction plate barcoded, superscript vilo cdna synthesis kit

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Corporations And Associations And Others

CTN :38767761

04 Apr, 2025 NA

Hisar - Haryana

Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)

CTN :39809563

14 Apr, 2025 1.21 Crore

Delhi - Delhi

Tender For supply of complement c3 , complement c4 , rheumatoid factor rf , c-reactive protein crp 300 test , immunoglobuline iga 300 test , immunoglobuline igg 300 test , immunoglobuline igm 300 test , diluent 1 4x120ml , dilution segment 1x100pkg , wash solution 1x10l , cal 1 4x3ml , cal 5 4x3ml , control vigil protrin level 2 4x5ml , control vigil serology level 2 4x5ml , cuvette scector 39 pkg , buffer l 4x120ml , buffer ll 4x120ml , buffer lll 4x120ml

Central Government/Public Sector

CTN :39774693

12 Apr, 2025 NA

Kanchipuram - Tamil Nadu

Tender For supply of items for protein studies - ml040 to 500ml 5x tris sds buffer ph 500ml , ml039 to 500ml 2.5 x tris sds buffer ph 500ml , 10x tris glycine sds gel running buffer , acrylamide bisacrylamide solution 30 percent , prestainer protein ladder 10ln , bradford reagent 500ml , tris free base 500gm hhimedia , grm6365 to 500g di sodium hydrogen phosphate dihydrate , potassium dihydrogen , ml016 to 500ml 50 xtae used for gel electrophoresis , ml013 to 500ml to 1m tris cl ph 8 , ml123 to 1ktsilver staining kit , lysozyme 5gm , cms1889 to 1grifampicin 1gm , ammonium sulphate 500 gm , dodecyl sulphate sodium salt for mb 25gm , parafilm m 2 x 250 1pk roll , silver sulphate hi lr 25gm , albumin bovine fraction v 5gm , sd028-1vl penicillin g p 10units , storage vials pp 10ml sterile 300 pk pack tarson , glutaraldehyde solution 25 percent 25ml

State Government

CTN :39790096

17 Apr, 2025 NA

Guwahati - Assam

Tender For empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii)sodium hydrox

	Mar 2025
Su	Mo	Tu	We	Th	Fr	Sa
23	24	25	26	27	28	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	29
30	31	1	2	3	4	5

	Feb 2025
Su	Mo	Tu	We	Th	Fr	Sa
26	27	28	29	30	31	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	1
2	3	4	5	6	7	8

	Mar 2025
Su	Mo	Tu	We	Th	Fr	Sa
23	24	25	26	27	28	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	29
30	31	1	2	3	4	5

	Feb 2025
Su	Mo	Tu	We	Th	Fr	Sa
26	27	28	29	30	31	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	1
2	3	4	5	6	7	8

Silica Powder Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector

Corporations And Associations And Others

Central Government/Public Sector

State Government