Latest sodium acetate trihydrate Tenders | Government sodium acetate trihydrate Tenders

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39848644

29 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.09) iv fluid containing dextrose 5gm, sodium chloride 0.09gm, potassium chloride 0.15gm, sodium acetate trihydrate 0.028gm, sodium metasulphite 0.021gm and dibasic potassium phosphate 0.13gm per 100ml in 500ml bottle (isolyte m or equivalent)

CTN :39796670

25 Mar, 2025 NA

Nadia - West Bengal

Tender For quotation for arsenic standard solution (500 ml), sodium acetate trihydrate (250 q), ammonium hydroxide solution (2.5 l), potassium iodide (250 gm), sodium arsenate (250 q) and glass wares

CTN :39679721

04 Apr, 2025 25.83 Lacs

Delhi - Delhi

Tender For supply of chemicals and kits - mops buffer 25g , triton x 100 100ml , beta 2 mercaptoethanol 100ml , integrin beta1 or itg b1 a4 antibody 200ug per ml , dnase i 100mg , rnase zap 250ml , acetone emplura 500ml , trolox 500mg , isoflurane 250ml , crotaline 1gm , urethane 100gm , protease inhibitor cocktail 100x 1ml , carboxy methyl cellulose sodium salt 500gm , acrylamide 1kg , copper sulphatehexahydrate 500gm , exo rneasy midi kit 50reactions , molecular grade ethanol 500ml , paraformaldehyde 500gm , evans blue 10gm , depc treated water 500ml , formamide 100ml , temed 100ml , nitrocellulose membrane roll , skim milk powder 500gm , dpbs,nocalcium,no magnesium 500ml , sodiumphosphate, monobasic,monohydrate 500gm , meta phosphoric acid 100gm , cd63 antibody 200ug per ml , dtnb 5gm , rna later 100ml , ripa buffer 10x 100ml , reverse transcription kit 50reactios , lys c endoproteinase,ms grade 20ug , ecl 2x250ml , cd9 antibody 200ug per ml , cd31 or pecam 1 antibody 100ug , cd41 antibody or integrin alpha 2b antibody 100ug per ml , alpha actinin 4 antibody 200ug per ml , calnexin recombinant rabbit monoclonal antibody 100ul , endothelin 1 monoclonal antibody 100ul , epcam polyclonal antibody 100ug , rneasy mini kit 50reactions , goat anti rat igg h and l secondary antibody 1ml , bca protein assay kits 100 reactions , goatanti rat igg h and l secondary antibody,hrp 1ml , goat anti human igg secondary antibody, hrp 1ml , epas 1 or hif 2 alpha antibody 200ug per ml , goat anti humanigg h and l secondaryantibody 1mg , collagenase d 100mg , rat sod elisa kit 96well , rat ace elisa kit 96well , glutathione peroxidase assay kit 480tests , rna blood mini kit 50reactions , human nox4 nadph oxidase 4 elisa kit 96well , rat et1 elisa kit 96well , rat xanthine oxidase elisa kit 96well , apob antibody 200ug , rat renin elisa kit 96well , anti hsp 90 antibody 100ug , quercetin 10gm , sample buffer laemmli 2xconcentrate pack of 10 vials , sequencing grade modified trypsin 5 x20ug , formicacid 98 to 100percent 50ml , nadh, disodium salt 1gm , ethanol 500ml , 2 thiobarbituric acid analytical reagent 99percent 100gm , protein dual colour standard 500ul , hif1a antibody 200ug per ml , beta tubulin antibody 200ug per ml , sybr green pcr kit 200reactions

State Government

CTN :39387370

26 Mar, 2025 90.00 Lacs

Delhi - Delhi

Tender For notice inviting open e-tender under rate contract for chemicals/ media items for mamc. -c001 napthyl acetate c002 10x pbs, ph-7.0 c003 10x tris-glycine sds buffer c004 10x tris-tricine sds buffer c005 2-thiobarbituric acid c006 3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl-2h-tetrazolium bromide (mtt) c007 3,3?-diaminobenzidine (dab) c008 4-4diaminodiphenyl dihydrochloride c009 5x blot transfer buffer c010 6x loading dye for dna agarose electrophoresis c011 absolute alcohol ar c012 absolute alcohol lr c013 absolute ethanol ar c014 absolute ethanol molecular biology c015 acetic acid hplc c016 acetic acid molecular biology c017 acetone lcms/ hplc grade c018 acid fuchsin c019 acrylamide molecular grade c020 adonitol disc c021 agar powder bacteriological for use in molecular biology c022 agarose (purity sigma) molecular grade c023 agarose for molecular biology c024 alberts stain a c025 alberts stain b c026 alberts metachromatic stains kitc027 alcian blue (74240) c028 alizarin red s c029 alkaline peptone water c030 alpha-naphthylamine pure powder c031 aluminium chloride c032 aluminum sulphate c033 ammonium hydroxide ar c034 ammonium hydroxide pellets ar c035 amplitaq gold dna polymerase c036 anaerobic blood agar plate (kanamycin vancomycin laked) c037 andrades indicator c038 aniline blue (42755) c039 antibiotic powder cefiderocol c040 antibiotic powder - cyclohexamide/actidione c041 antibiotic powder amikacin sulphate (pure powder) c042 antibiotic powder amphotericin b c043 antibiotic powder aztreonam (pure powder) c044 antibiotic powder cefotaxime sodium salt (pure powder) c045 antibiotic powder ceftrixone sodium salt (pure powder) c046 antibiotic powder chloramphenicol (pure powder) c047 antibiotic powder colistin sulfate (pure powder) c048 antibiotic powder cycloheximide/ actidione c049 antibiotic powder dalbavancin (pure powder) c050 antibiotic powder daptomycin (pure powder) c051 antibiotic powder erythromycin (pure powder) c052 antibiotic powder fluconazole c053 antibiotic powder fosfomycin c054 antibiotic powder gentamicin (pure powder) c055 antibiotic powder imipenem monohydrate (pure powder) c056 antibiotic powder itraconazole c057 antibiotic powder kanamycin powder c058 antibiotic powder ketoconazole c059 antibiotic powder linezolid (pure powder) c060 antibiotic powder meropenem (pure powder) c061 antibiotic powder miconazole nitrate c062 antibiotic powder nalidixic acid (pure powder) c063 antibiotic powder netillin (netilmicin sulphate) (pure powder) c064 antibiotic powder nitrofurantoin (pure powder) c065 antibiotic powder oritavancin (pure powder) c066 antibiotic powder oxacillin (pure powder)c067 antibiotic powder penicillin-g sodium (pure powder) c068 antibiotic powder potassium clavulanate (pure powder) c069 antibiotic powder teicoplanin (pure powder) c070 antibiotic powder tetracycline hydrochloride (pure powder) c071 antibiotic powder vancomycin hydrochloride (pure powder) c072 antibiotic powder voriconazole c073 antibiotic-antimycotic c074 antimicrobial gradient strips to determine mic anidulafungin strips 0.002-32 mcg/ml c075 antimicrobial gradient strips to determine mic caspofungin strips 0.002-32 mcg/ml c076 antimicrobial gradient strips to determine mic fluconazole strips 0.002-32 mcg/ml c077 antimicrobial gradient strips to determine mic flucytosine strips 0.002-32 mcg/ml c078 antimicrobial gradient strips to determine mic itraconazole strips 0.002-32 mcg/ml c079 antimicrobial gradient strips to determine mic ketoconazole strips 0.002-32 mcg/ml c080 antimicrobial gradient strips to determine mic micafungin strips 0.002-32 mcg/ml c081 antimicrobial gradient strips to determine mic posaconazole strips 0.002-32 mcg/ml c082 antimicrobial gradient strips to determine mic voriconazole strips 0.002-32 mcg/ml c083 aprotinin molecular grade c084 arabinose disc c085 arginine hydrochloride amino acid disc c086 ascorbic acid hplc grade c087 azure ii c088 bacterial lysis buffer for dna extraction c089 bacteriode

Sodium Acetate Trihydrate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government