Latest sodium chloride Tenders | Government sodium chloride Tenders

Central Government/Public Sector

CTN :39848644

29 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.09) iv fluid containing dextrose 5gm, sodium chloride 0.09gm, potassium chloride 0.15gm, sodium acetate trihydrate 0.028gm, sodium metasulphite 0.021gm and dibasic potassium phosphate 0.13gm per 100ml in 500ml bottle (isolyte m or equivalent)

Central Government/Public Sector

CTN :39848740

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.24) iv solution ringer lactate containing sodium hydroxide 0.32gm, sodium chloride 0.50gm, potassium chloride 40mg, calcium chloride mg, 500ml bottle

Central Government/Public Sector

CTN :39848743

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.04) infusion dextrose 5% w/v with 0.9% w/v sodium chloride solution iv 500ml bottle

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

Central Government/Public Sector

CTN :39846599

16 Apr, 2025 NA

East Singhbhum - Jharkhand

Tender For supply of mg domperidone 30 mg. cap or tab. , pantaprazole 40 mg . tab. , rabiprazole 20 mg domperidone 30 mg. tab. , omeprazole 20 mg. cap , ondansetron 4 mg. tab. , calcium 500 mg. tab. , allopurinol 100 mg. tab. , febuxostat 40 mg. tab. , betahistine 8 mg. tab. , albendazole 400 mg. tab , i. v. sodium chloride 0.9 percent 500 ml , i.v. mannitol 20 percent 100ml , levolin respules 0.31 mg , budecort respules 0.5 mg , olmesartan 40mg. tablet , teneligliptin 20mg. tablet , ors 21.8gms. , i.v sodium chloride 0.9 percent 100ml. , diclofenac 50mg tablet , paracetamol 650mg tablet , dexamethasone sodium phosphate 4mg. injection 2ml. , promethazine hydrochloride 25mg injection 2ml. , lignocaine hydrochloride 2 percent injection 30ml. , lignocaine hydrochloride and adrenaline bitartrate injection 30ml. , metoclopramide hydrochloride 5mg. injection 2ml. , phenytoin sodium 50mg. injection 2ml. , dopamin hydrochloride 40mg injection 5ml. , etofylline and theophylline injection 2ml. , frusemide 10mg injection 4ml. , diphenhydramine hcl ammonium chloride sodium citrate and menthol syrup 100 ml cough syrup , paracetamol 125 mg tab , i.v dextrose 25 percent 100 ml , drotaverine hychloride 40 mg injection , ondansetron 2 mg injection , hyoscine butylbromide 20 mg injection , pantoprazole 40 mg injection , cefuroxime 500 mg tab , paracetamol injection , diazepam injection , pentazocine injection , etophylline and theophylline 150mg tablet , etophylline and theophylline 300mg tablet , hydrocortisone sodium 100 mg injection , adrenaline bitartrate injection , atropine sulphate injection , dapagliflozin 10mg , tetanus toxide 0.5 ml injection , lignocaine 2 percent jelly 30 gms , i.v electrolyte p 500 ml

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39835249

16 Apr, 2025 25.73 Lacs

North 24 Paragana - West Bengal

Tender For procurement of generic medicines - cream.permathrin 5 percent 30gm , drop.ciprofloxacin 0.3 percent eye 5ml , drop.xylometazoline 0.1 percent nasal decongestant adult 10ml , inj.dexamethasone 4mg per ml 2ml , inj.diazepam 10mg per 2ml , inj.dicyclomine 10mg per ml 2ml , inj.metoclopramide 5mg per ml 2ml , inj.ondansetron 2mg per ml 2ml , inj.pantoprazole 40mg , inj.pheniramine maleate 22.75mg , lignocaine hcl gelly 2 percent 30gm , lotion.povidone iodine 10 percent 500ml , mdi levosalbutamol 50mcg per dose , sterile water for injection 10ml , syr.albendazole 10ml , amoxycillin 200mg clavulanic acid 28.5mg and lactic acid bacillus 60 million spore dry syrup , syr.cefixime 50mg per 5ml bott of 30ml , tab.clobazam 5mg , tab.clopidogrel75mg , tab.enalapril 5mg , tab.escitalopram 10mg , tab.folic acid 5mg , tab.isosorbide 5 mononitrate 20mg , tab.levothyroxin 25mcg , tab.levothyroxine 100mcg , tab.levothyroxine 50mcg , tab.metformine 500mg sr , tab.metformin sr 1gm , tab.metoprolol 50 mg xl , tab.ondansetron 8mg , tab.prednisolone 5mg , tab.ramipril 5mg , tab.telmisartan 40mg , tab.telmisartan40 plus hydrochlorthz 12.5 mg , cap.tamsulosin 0.4mg , cap.vitamin e 400mg , ferrous ascorbate 100mg and folic acid 1.5mg tablets , clotrimazole1 percent powder 100gm , cream.silver sulphadiazine1 percent weight per weight 20gm , drop.ciprofloxacine plus dexamethasone 10 ml , drop.multivitamin bottle of 15ml , drop.sodium chloride nasal , inj.amikacin 250mg , inj.etophyllin 84.7mg plus theophylline 25.3mg per ml , inj.hydrocortisone sodium succ.100mg , inj.lignacaine 2 percent , inj.lignacaine 2 percent plus adrenalline , inj.tranexamic acid 500mg per 5ml , mdi ipratropium bromide plus levosalbutamol , oint.betamethasone 0.05 percent plus salicilic acid 3 percent 25gm , oint.mometasone 0.1 percent 10gm , oint.mupirocin 2 percent 5gm tube , heparin sodium 50iu and benzyl nicotinate 2mg ointment 20gm , levo-salbutamol 1.25mcg plus ipratropium 500mcg respules 2.5 ml , ambroxol hydrochloride 15 mg guaifenesin 50 mg and levosalbutamol sulphate 1 mg syrup , phenylephrine 5 mg chlorpheniramine 2 mg and dextromethorphan 10 mg syp , tab.aciclovir 800mg , tab.alprazolam 0.25mg , tab.aspirin enteric coated 150mg , tab.aspirin enteric coated 75mg , tab.betahistine hcl16mg , tab.cinnarizine 25mg , tab.etophylline-115 plus theophylline-35mg in slow release , tab.febuxostate 40mg , tab.fenofibrate 200mg , tab.finasteride 5mg , tab.glucosamin 500mg , tab.nor-ethisteron 5mg , tab.torsemide 10g , tab.voglibose 0.2mg , tab.voglibose 0.3mg , tab per cap.pregabolin 75mg , tab per cap.vitamin b complex b1 b6 b12 , antiseptic mouth wash chlorhexidineip 0.2 percent weight per volume 100ml , vit. d3 sachet cholecalciferol 60k , tab.teneligliptin 20mg , clotrimazole mouth paint 1 percent weight per volume 25ml , syp.ondansetron 2mg per 5ml 30ml , tab.montelukast10 plus levocetrizine , glyceryl trinitrate cr 2.6mg , mouth ulcer gel choline salicylate sodium 9 percent weight per volume benzalkonium chloride 0.01 percent weight per weight 10gm , drotaverine hcl tablets 40mg , atropine sulphate injection ip 0.6mg per ml 1ml , gabapentin capsules ip 300mg , carvedilol tablets ip 3.125 mg , tabsosorbide dinitrate ip 10mg , dopamine hydrochloride injection ip 200 mg per 5ml , streptokinase inj. ip 15 00 000 iu 10ml , carboxymethlycellulose eye drop 1 percent weight per volume 10ml , tranexamic acid tablets ip 500 mg , propranolol tablets ip 40 mg , lactulose solution 10g per 15ml 100ml , tab pregabalin sr75mg plus methylcobalamin 750mcg , sitagliptin phosphate tab. ip 100mg , dapagliflozin tablets 10 mg , inj.enoxaparin ip 40 mg per 0.4 ml , inj. enoxaparinip 60 mg per 0.6 ml , adenosine injection 3mg per ml 2 ml , phenytoin tablets ip 100 mg , metoprolol succinate pr 25mg tablets ip 25mg , rabeprazole gastro resistant tablets ip 20 mg , esomeprazole tablets ip 40mg , miconazole nitrate cream ip 2 percent , luliconazole cream ip 1 percent weight per weight 10gm , inj.tramadol

CTN :39848836

11 Apr, 2025 NA

Multi City - Multi State

Tender For supply of each 100 ml contains- ofloxacin 200 mg with sodium chloride 0.9 for iv use packing in bottle

CTN :39847099

11 Apr, 2025 50.20 Lacs

Dharwad - Karnataka

Tender For supply of tissue paper rol , lead apron , vicrl 3-0 , ethilon 1 , ethilon 2-0 , ethilon 3-0 , prolene 1 , prolene 1-0 , prolene 2-0 , surgical blade no. 22 1x100 , surgical blade no. 23 1x100 , surgical blade no. 24 1x100 , cyclophosphamide 750 mg , 5-fluorouracil 750 mg , inj adriamycin 75 mg , thermal paper 50 mm x 20 m , blood transfision drip set , oxygen mask pediatric , oxygen mask audult , nebulizer mask audult , nebulizer mask child , surgical blade no. 11 , surgical blade no. 15 , tab amlodipine 5mg , syp salbutamol or ambroxol , calamine lotion , tab glimepiride 1mg , tab amoxycilin clavunate 625mg , inj lorazepam 2mg , inj midazolam , normal sailne , iv dextrose with sodium chloride 500ml , iv ciprofloxacin 100ml , iv metrogyl 100 ml , inj dicyclomine 2ml , inj buprigesic 2ml , inj ondensetron 2ml , inj cyanocobalamin 2ml , inj tramadol , tab thyroxine sodium , tab thyroxine sodium ip , inj lignocaine with adrenaline , rabies antiserum i.p equine , rigner lactate

Sodium Chloride Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors