Latest sodium hypochlorite sale Tenders | Government sodium hypochlorite sale Tenders

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39836121

16 Apr, 2025 NA

Kollam - Kerala

Tender For supply of sodium hypochlorite solution (v2) as per is 11673 (part 1) (q2)

CTN :39827820

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials in hulical town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39827891

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials - public health materials, bleaching powder(p/h), bleaching powder(w/s), white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, lyzol floor cleaner disinfectant, sodium hypochlorite solution, mask, emi stock solution, soap oil, (harvicide), fogging gas cylinder, rubber glouse, cotton gloves, rain coat(male & female), life jacket with reflector, helmet, gum boot, plastic basin, 50 lit syntax backet, white lime powder, , ( ), ( ), ( ), , ( ), ( ), ( ), ( ), , , , , 80 lit syntax bucket, 4 pin hook with pipe handle (sumal), 4 pin hook with pipe handle (big), grass knife, hand sanitizer, sprayers(12 liters capacity), sprayers(16 liters capacity), plastic koodai(sumall), syntex bucket (50 lit), syntex bucket (70 lit), plastic koodai(big), 24 mm crowbar, 25mm crowbar, shawel, water testing kit

CTN :39828261

29 Apr, 2025 20.00 Lacs

Chhatarpur - Madhya Pradesh

Tender For supplying of various types of chemical and powder material for financial year 2025-26 under municipal council chhatarpur - esolic powder, phenolic powder, carbolic powder, dusting powder, deo dezing powder, coro dusting powder, disinfect powder, malaria oil, antilarva oil, white floor cleaner, black floor cleaner, deo dezing lad, toilet cleaner, fogging oil, sodium hypochlorite solution, bleaching powder, glass cleaner, floor cleaner, napthalene bals, handwash, ferric alum grade - i, white phenyl, black phenyl

CTN :39830487

15 Apr, 2025 1.57 Lacs

Unnao - Uttar Pradesh

Tender For supply of sodium hypochlorite naoci in nagar palika parishad bangarmau unnao

CTN :39809138

28 Mar, 2025 10.00 Lacs

Nilgiris - Tamil Nadu

Tender For supply of public health materials in sholur first grade town panchayat 2025-2026 - bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

Central Government And Public Sector

CTN :39814566

04 Apr, 2025 NA

Kalpakkam - Tamil Nadu

Tender For supply of sodium hypochlorite (naocl) grade-1 for drinking water chlorination , sodium hypochlorite (naocl) commercial grade-2 for sea water chlorination

CTN :39222825

28 Mar, 2025 17.13 Lacs

Ferozepur - Punjab

Tender For bid to ras bid to ras tender for supply of bupivacaine hcl 5 mg ml heavy 4 ml inj , diclofenac diethylamine 2.32 quick penetrating topical solution30 ml bottle with metered dose spray , tab topiramate 50mg , artesunate 60mg inj , tab levodopa cr 250 mg , tab fenofibrate 160 mg , fenofibrate 200 mg tab , lignocaine hcl solution 2 percentage for iv use 50 ml inj , labetalol hcl 100 mg tab , labetalol hcl 5mg ml 4ml inj , para dichlorobenzene 2 per w v benzocaine 2.7 per w v chlorbutol 5 perturpentine oil 15 per bott of 10 ml , chlorhexidine gluconate 2 per in 70 per isopropyl alcohol 500 ml bott , glutaraldehyde 2 per with opa with checking strips , povidone iodine solution 5 per bottle of 100 ml , cilnidipine 5 mg tab , tab entacavir 0.5 mg , pantoprazole 40mg plus domperidone 10mg sr , carboprost tromethamine 250 mcg ml 1ml inj , oxytocin 5 units per 1.0ml amp inj , human insulin analogue glargine inj , 100 iu ml recombinant dna origin 300iu disposable pen with 5 needles per pen , olaptadine hcl 0.1 per eye drop with drop dispensor technology bott 5ml , alprazolam 0.25 mg tab , lorazepam 1 mg tab , levosalbutamol sulphate 2.5 ml containing 1.25 mg respule , tiotropium bromide 9 mcg 120 metered dose inhaler , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inhaler of 60 doses , nitrofurantoin 100 mg tab , tetanus toxoid purified absorbed vaccine 0.5ml , tube endo tracheal reinforced pvc size 7.0 with cuff , tube endo tracheal reinforced pvc size 7.5 with cuff , bandage full arm lymphoedema sleeve small classiii 34 46mm hg , bandage full arm lymphoedema sleeve medium class iii 34 46mm hg , bandage full arm lymphoedema sleeve large , comfort caps , lint absorbent cotton , set infusion microdrip presterilised disposable for paediatric use consisting of nontoxic pvc tubing 1700mm with drip chamber of minimum 1000ml , syp osteo calcium bott of 200 ml , tab mecobalamin folic acid pyridoxine b1 b6 , inj neurobion , tab neurobion , fas kit , ecg roll large , troponin t test card , tab premipaxole 0.25 , tab paroxetine , spacer device , tab feropenum 60 mg , eye drape , urostomy kit , syphilis rapid kit , tab leflunomide 20mg , tab misoprostol 200 mg , cap omega 3 f acid m vitamin minerals anti oxidant soft gel , eye drop systane dehydration , tab nitroglycerin 2.6 mg , troponin i test , automatic developer , tab clinidipine 10 mg , sulphamethoxazole 400 mg trimethoprim 80mg tab , ketamine hcl 50 mg ml 2 ml inj , vecuronium bromide 4mg ml 1 ml inj , hydrochlorothiazide 25mg , suture sterilised surg nedled suture polyglactine 910 fast absobable size 1 0 half half cicle tapper cut 40 mm double arm , inj nitroglycerine glyceryltrinitrate 5 mg , trypsin with chymotrypsin tab , levetiracetam 100mg ml vial of 5 ml inj , nortriptyline 25 mg tab , suspensory scrotal , bandage triangular , bandage t shaped , hfnc paediatric circuits hioxy 1570s , hfnc adult circuits hioxy 1570s , surgical gun , inj hcg 5000 , syp multivitamin , rifampicin 150mg cap , tab aceclofenac paracetamol serratiopeptidase , suture vicryl 2 by 0 fast absorb , desmopressin 0.2 mg tab , cholin salicylic acid mouth ulcer gel , mesalazine 2gm sachet , syp ambroxol plus guipheneson , trihexyphenidyl hcl 2 mg tab , atropine sulphate 0.6 mg 1 ml inj , common cold tab cetrizine 5mg paracetamol 500 mg pseudoephedrine 30 to 60mg , tab thalidomide 50mg , ethinyl estradiol 0.035mg cyproterone acetate 2mg pack of 21tablets , dinoprostone gel 0.5mg in 3gm 2.5ml gel syringe , sodium hypochlorite 5 percentage , laryngoscope cells for. size aaa , sodium chloride 3 per inj bott of 100 ml , aa battery , dynapar spray , tetracyclin ip 500 mg cap , cyclosporine a micro emulsion 25 mg cap , cyclosporine a micro emulsion 100 mg cap , clonidine 100 mcg tab , bacillus clausii 2 billion spores 5 ml , metoclopramide hcl 5mg ml 2ml inj , syp sucralfate 1000 mg 10 ml plus oxetacaine 10 mg 10ml bottle of 100 ml , drotaverine hcl 1 per 20 mg ml 2 ml inj , delivery system for salmeterol

Sodium Hypochlorite Sale Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others

Central Government And Public Sector