Latest sodium meta silicate Tenders | Government sodium meta silicate Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

CTN :38957815

28 Mar, 2025 NA

Sonipat - Haryana

Tender For bid to ras corrigendum : supply of potassium iodide as per is 7163 (q3)

State Government

CTN :39790096

17 Apr, 2025 NA

Guwahati - Assam

Tender For empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii)sodium hydrox

Central Government/Public Sector

CTN :39774589

12 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.

CTN :39798792

27 Mar, 2025 7.50 Lacs

Sirohi - Rajasthan

Tender For supply of lab equipment chemistry - test tubes , safety goggles , latex gloves , bunsen burner , thermometer , microscope , graduated cylinders , conical flasks , boiling flask(tubs) , droppers , pipette , ring stands, rings, and clamps: , burettes , tongs and forceps: , spatulas and scopulas: , litmus and filter papers: , melting point apparatus mechanical type , thieles tube 18x150mm , wening , pocket type conductivity/tds meter , filter paper sheet , water bath , heating mental , watch glass (small-30, large 30) , funnel (plastic-30, glass-30) , volumetric flask 100ml , volumetric flask 250ml , volumetric flask 500ml , volumetric flask 1000ml , glass rod , spatula , measuring cylinder 10ml , measuring cylinder 25ml , measuring cylinder 50ml , reagent bottle n m. 125ml , burner , calorimeter , anthracene , phthalic acid , urea , nepthaline , a-narithol , b-narithol , oxalic acid , cinnamic acid , benzophenone , m-dinitrobenzene (100gm) , hydrochloric acid , starch soluble , potassium dichromate , resorcinol , iodine monochloride , glucose , salicylaldehyde acid , pyridine , acetyl chloride , ethanol , potassium hydroxide pellets , tartaric acid , mercuric chloride , ammonium thiocynates , aniline , benzoil chloride , citric acid , benzoic acid , diphenylamine , ester , nesslar reagent , picric acid , ferric chloride , phenol , thiourea , potassium ferrocynide , potassium iodide , schiff reagent , glycrine , dimethyl gloxime , mangnese dioxide , potentiometer , thermostat (electical) , microwave 21 ltr , electronic malatice (precision) , digital water balt , magnets sturer (1kg) , table top balance (300gm) , stalagmometer , viscometer (ostwald) , beaker (500 ml-20, 100ml-20, 200ml-20, 50ml-20, 1l-3, , 5l-2) , conductivity bridge with flectrode

Central Government And Public Sector

CTN :39775625

11 Apr, 2025 NA

Chittorgarh - Rajasthan

Tender For supply of ammonia solution 25% (q3) , ammonium chloride reagent grade (q3) , potassium iodide as per is 7163 (q3) , zinc acetate (q3) , hydrochloric acid as per is 265 (q3) , carbon tetrachloride as per is 718 (q3) , nitric acid (v2) as per is 264 (q3)

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39796670

25 Mar, 2025 NA

Nadia - West Bengal

Tender For quotation for arsenic standard solution (500 ml), sodium acetate trihydrate (250 q), ammonium hydroxide solution (2.5 l), potassium iodide (250 gm), sodium arsenate (250 q) and glass wares

Corporations And Associations And Others

CTN :39422929

03 Apr, 2025 51.44 Crore

Panchkula - Haryana

Tender For corrigendum : online tender for the rate contract for the supply of dental items to various hospitals of government of haryana for a period of two years for group c - cotton rolls ( small, pkt of 1000 pcs), disposable patient drape sheet 1*1mm, gum paint based on tannic acid, potassium iodide, zinc chloride, glycerine with thymol/ menthol /cetrimide, liquid 15 ml bottle, hybrid composite resin for anteriors (all shades), high strength, long lasting wear resitance, great handling without stick, 4 gm isi/ iso/ce/marked., rubber dam kit adult, box of 152*152 mm, medium rubber dam sheets, 152 mm template, 152 mm plastic dental dam frame, 6-11 clamps pack with clamp holder, rubber dam clamp forcep, rubber dam punch mdr/isi/iso/ce marked, glass ionomer cement- type-ix, high strenth for posterior teeth, chemical setting without shrinkage, strontium based, high flouride releasing, 12 to 15 gm powder and 5 to 10 gm liquid, mdr/isi/iso/ce marked, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel. shade :- pale yellow, shade :- pale yellow, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- yellow brown, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- dark grey, mdr/isi/iso/ce certified /usfda, disposable suction tips pkt of 100, mineral trioxide aggregate mdr/isi/ iso/ce/marked., silver alloy non gamma-2 lathe cut alloy, 30 gm vial mdr/isi/iso/ce marked, niti hand files (21 mm) size- 15-40, for curved canals, pkt. of six mdr/isi/iso/ ce marked, pit & fissure sealant ( 6 ml bottle) solution with high flouride releasing, low viscocity, high retention, rapid cure & low solubility. mdr/isi/iso/ce marked/usfda, preadjusted edgewise stainless steel bracket kit containing upper and lower 2nd premolar to 2nd premolar bondable brackets with upper triple and lower double weldable molar tubes and mbt 0.022 prescription, fiber- reinforced splinting material- bondable reinforced ribben fiber-approx 2mm width mdr/isi/ iso/ce/marked., niti rotary files 4% 21mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be specified at the time of order), addition silicone impression material (600 ml putty with 2 cartridges of 50 ml light body), air rotor spray isi/iso/ce marked, calcium hydroxide, paste system based and catalyst -radiopaque, 4 gm mdr/isi/iso/ce marked, acidulated phosphate fluoride gel 1.25%(apf), gic luting pkt. of 30-35gm powder, flowable composite 2-4 grams, x-ray processing solution(set of developer & fixer powder, manual, to make 13.5 ltr solution), root canal spreaders pkt. of 6 #15-40 21mm, dental chair covering sterilized cling foil rolls mdr/isi/ iso/ce/marked., mta pkt. of 1gm, tooth preparation kit (set of 14 burs), root canal k files 21mm (pkt. of 6) #15-40, dental amalgam capsules pkt. of 50 capsules, impression compound, gic restorative pkt. of 10-15 gm powder, bleaching kit, diamond burs- various shapes including round, tapered round, flat fissure, pear (size and shape of burs required will be specified at the time of order)- coarse / fine grit. pkt of 5, niti rotary files 4% 25mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be spe

Sodium Meta Silicate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others

State Government

Central Government/Public Sector

Central Government And Public Sector

Corporations And Associations And Others