Web Analytics Made Easy - StatCounter

Sodium Sulphute Tenders

Get complete information related to latest Sodium Sulphute Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sodium Sulphute Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sodium Sulphute Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39541968 Due date: 29 Mar, 202529 Mar, 2025 6.00 Lacs
Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

State Government

CTN :39826251 Due date: 10 Apr, 202510 Apr, 2025 50.00 Lacs
Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39826384 Due date: 22 Apr, 202522 Apr, 2025 NA
Tender For tender for supply of surgical and consumables hospital furniture etc to assam medical college hospital dibrugarh - supply of surgicals, consumables and hospital furniture, absolute alcohol, absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip 300gm roll, adhesive tape 7.5cm x 5 mtr spool, alcohol swab, aldheyde free disinfectant, anti septic solution 1000 ml, bandage 90cm x 18mtrs,, betadin ointment tube/nanz/ collapsible tube, betadin solution 500ml (5%), bleaching powder, cannula fixer, cidex solution 2.45% 1000 ml, collagen sheets 10 x 10cm, cotton crepe bandage b.p. size: 4mtr x 6 cm, cotton roll 500gm, disinfection solution 5 ltrs jar, elastic adhesive bandage 10cm x 1mtr, formalin, gauge cloth 90cm x 18mtr, gauge swab non sterilized, gauge swab sterilized, glycerol, hand sanitizer, hand wash 500ml bottle/, hydrogen peroxide, hypoallergenic non-woven tape, size: 5m x 2.5cm, hypoallergenic non-woven tape, size: 5m x 5cm, lysol, mackintosh sheet, methylated spirit 1 ltr jar, micro-porous plaster size: small/each box, micro-porous plaster size: big/each box, paper adhesive size: 1" x 9.0 mts, paraffin gauge dressing b.p. size: 10cm x 10cm, phenyl 450 ml bottle, phenyl solid, plaster of paris bandages bp size: 15cm x 2.7 mts, plaster of paris bandages bp size: 10cm x 2.7 mts, raxin sheet, rectified spirit 450ml, roll bandage 10cm x 5mtrs, rolled bandage 5cm x 5mtrs, 100gm/doz, rolled bandage 5cm x 5mtrs, 60gm/doz, savlon, senitary napkin, sodalime 5kg jar, surgical gauge pad, back rest, bed side screen 4 fold, biomedical waste bin trolley, door screen white, size: 200cm x 114cm/, dressing trolley, dressing trolley big size, ecg trolley, foot step (double step), foot step (single step), fowler bed (deluxe), hygiene trolley, icu bed (fowler), icu bed (mannual), icu bed with remort control, instrument trolley, instrumet cabinet, medicine cabinet, medicine trolley, mosquito stand, orthopedic bed, oxygen cylinder carrying trolley, oxygen cylinder trolley (d-type) 140cm hight tubular ms frame work fitted with wheel 125mm dia., patient carrying trolley, patient examination bed, patient examination couch, patient examination table, pediatric bed, revolving stool, revolving stool ss, saline warmer, semi fowler bed, semi fowler bed (super) with mosquito net stand, sevotec veporiser, stretcher, stretcher on trolley, waiting chair (regular), ward bed (general), wheel chair, mosquito artery forceps, speculam, pvc pipe for central line, reservior bag for anaesthesia machine, anathesia face mask 0,1,,2,3, black rubber mask 1,2,3,4, uterine sound, towel clip, ecg paper for schiller machine model at2 per packet, ecg paper for edan machine per packet, laryngeal mask airway size 1,1.5,2,2.5, i gel size 1,1.5,2,2.5, bowl stand, sterlized drum trolley, volcellum, post vaginal well retractor, cup t removal hook, anti vaginal well retractor, cunalty, coscors self retractor, angle lip retractor, hegari dilator, theraputic paraffin wax, absolute alcohol (denaturated alcohol), absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip, 300 gm roll, adhesive tape, 7.5cm x5mtr spool, alcohol swab, aldheyde free disinfectant, all container vial ( non vaccum, non iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, etc., all container vial (vacuum, iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, z no add, k2, k3, allies tissue forceps, size: 6 , 8 , autoclave big, size:big, autoclave, size: medium, autoclave, size:small, b.p. bulb, b.p. handle stainless steel, size: 3, b.p. handle stainless steel, size: 4, bandage cloth, size:90cm x 18mtrs, 325gm, barium sulphate 5 kg jar, bed pan, betadin solution 500ml (5%), bleaching powder, blood administration set disposable sterilized, bp blade, size: 11,15,20,21,22,23,24, bp instrument stand type, bp instrument (mercurial) table model, b.p instrument (digital), cannula (3 way), cap (disposable), carbon di oxide b-type cylinder (as per latest iso s

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39668047 Due date: 03 Apr, 202503 Apr, 2025 NA
Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile
 Loading, Please wait...

Connect us via What's Up