Latest sulphur trioxide Tenders | Government sulphur trioxide Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39793600

28 Mar, 2025 10.00 Lacs

Dindigul - Tamil Nadu

Tender For suppling of public health material in sriramapuram town panchayat - bleaching powder (for water supply) isi grade 33% chlorin 1065 grade no.2, bleaching powder (for public health) isi grade 22% chlorin 1065 grade no.2, black phenoyl, abate 50% ec, hydrated lime powder, pyrethrum 2% extract, baytex 1000, fogg m/c. lpg cylinder, emi solution, organic jaggery (naatu vellam), fenthion 82.5% e.c, tempephos 50% ec, round up / glyphosate ( kalai kolli ), 2-4d oil, alum(sulphate of aluminium ferric), malathion, acid, bio larvicide, bt powder, non ferric acid, lysol, alcohol hand sanitizer, sodium hypo chloride, mask, n95 mask, gloves, a. 12" gloves, b. 18" gloves, c. oneside rubber coated gloves, d. surgical gloves, e. cotton gloves, mask, a.n95 mask, b. three layer, c. cotton mask, ppe kit, e.b gloves, cap, helmet, overcoat, foot boot, rain coat, reflector coat (green/orange), sweeper s coat (green) with sleeve, 50 litre can pull cart, 80 litre can pull cart, broom stick with handle, broom stick (thudaippam), crowbar (kadaparai), shovel with handle, forque with handle, pickaxe with handle, slump cleaner with handle ss(gi plate ), fiber ghamela small, fiber ghamela big, bamboo ghamela small, bamboo ghamela big, pull / push cart (two wheeler), pull / push cart (four wheeler), pull/push cart wheel tube, pull/push cart tyre, machete with handle (aaruval) big, machete (kaarukaruval) small, 3 mamooty with handle (kotthu), 6 mamooty with handle (kotthu), mamooty with handle, power sprayer heavy (fuel operated), power sprayer heavy (battery operated), g i bucket ( rice mill ), slump cleaner with handle ( agappai ), wooden handle for mamooty, pickaxe, kundalam, iron ghamela, pump stick miller with handle, 12 g i bucket, plastic mug, road cleaning brush, aluminium ghamela ( annakudai ), 200 litre can pull cart, action m l o, kundalam, bamboo ghamela (thattukoodai), calcium hpo choride soultion, hand wash liquid, covid 19 - bio medical waste yellow bag, hand gloves ( cotton , synthetic mixed), hand gloves ( synthetic ), one time use hand gloves, face shield safety & use, face mask ffp 1, medical infrared fore head thermometer, pulse oximeter, white phenyl, toilet cleaner thick liquid, lemon grace flavour soap oil, lemon grass oil, room fresher - perfume, full face chimical proofed gas mask (with filter), nitrile rubber hand gloves, pollution safety mouth, chappal (ladies & gents), safety nylon cap, raxin cap, sprayres ( 12 liters capacity), sprayres ( 16 liters capacity), coconut bamboo milar, canal spoon grip ( kongani), small fork with fork handle ( ), 50 ltrngarbage bin, garbage disposal plate ( ), sickle (small), bretex - for larve control, 5 lit bucket (plastic), , ( ), bleaching water, soap oil, reponsar (beta cyfluthrin 2.45 sc flying insect killer), ammonium sulphate, king fogg - high fogg ( delta methrin 1.25 ulv), reflector jacket, mamooty with handle, forque with handle, pickacc with handle, tata shovel with handle, crown bar, drainage mamooty with handle, fibre gamalish, bamboo gamalish - big, glouse, foot boot, cart type, cart tube, over coat, 50 litres can, broom stick, mask, 10" gi bucket, 12" gi bucket, gi mug, brush, bill hook, grass cutter with handle, coco broom stick with bamboo handle, 3" mamooty with handle (koththu), 6" mamooty with handle (koththu), kundalam, fibre ghamela - big, fibre ghamela - small, bamboo gamalish - small, iron ghamela, aluminium ghamela (annakudai), pull / push cart (two wheeler), pull / push cart (four wheeler), 200 litre can pull cart, machete with handle (aruval) -big, machete with handle (aruval) -small, slum cleaner with handle (gi plate), slum cleaner with handle (agappai), pump stick miller with handle, wooden handle for mamooty, pickace, kundalam, action m l o, helmet, cart tyre ( pull / push cart tyre), cart tyre ( pull / push cart wheel tube), 80 litres can pull cart, road cleaning brush, bamboo with handle, reflective jocket, bell, rice mill g.j bucket, bamboo plate, plastic bucke

Corporations And Associations And Others

CTN :38767761

04 Apr, 2025 NA

Hisar - Haryana

Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)

CTN :39798795

27 Mar, 2025 7.50 Lacs

Sirohi - Rajasthan

Tender For supply of lab items zoology gc reodar- el'plectella,, scyi'ha, hyalonema, spongllla, euspongia, metrldlum, aurelia,, alcyonium,, physalia,, corallium, gorgonia,, pennatula,, madrepora,, enterobius, dugesia, fasciola, taenia, schistosoma, dracunculus, ascaris (male and female), wucheraria, peripatus., nereis, heteronereis,, aphrodite,, arenicola,, chaetopterus, hirudin aria., onychophora :, limvlus,, aranea,, palajvfnaeus,, lepas,, balanus,, apus, sacculina, eupagurus,, carcinus, lepisma, pediculus, bombyx, apis, cimex,, julus,, scolopendra,, ixodes, mytilus., chiton., teredo., turbinella,, laviculus, limax, doris, aplysla, dentalium, nautilus, sepia, octopus, loligo, pecten, solen., pinctada, asterias, pentaceros., antedon., ophiothrjx., holothurla, hemichordata:, l.balanoglo us, 2.saccoglossus., urochordata- ciona, pyrosoma. doliolum salpa, cephalochordata- amphioxus, agnatha- petromyzon. ammocoete larva, pisces -echeneis., sphyr-na., torpedo., pristls., anabas., hippocampus., chjmaer-a.., anguilla,, protopterus, ampidbia, ichthyophts., axolotl larva, . salamander,, bufo., plpa., amphiuma, alytes, trionyx, calotes., varanus., phrynosoma,, heloderm . .<\,, vip era., typhlops, bungarus., hydrophis, eryx., aves-, p lttacula,, passer, bubo,, model of archaeopteryx, mammals, felis, erinaceous,, hystrlx crocedura,, manis, acinonyx juba tus,, equus caballus, mschus moschiferous., columba livia,, pteropus, dr.a,co,, exocoetus,, chamaeleon,, perlpetus, spinel' ant eater, permanent microscopic slides, protozoa, monocystis,, euglena,, noctiluca,, tr yp anosoma,, nyctotherus,, par.a,mecium,, vorticella,, blood smears showing malarial par."site., par."mecium: binary fission, conjugation, porifera, t.s. and l.s. of sycon., spicules,, spongin fffires and gemmules, coelenterata, lo belia (colony and medusa), planula, scyphistoma and ephyra larvae of aurelia,, t.s. of mesentry of metridium, pla tyhelmtnthes, mirl,cidium, sporocyst, redia and cercaria larvae of fasciola,, scolex of taenia, w.m. of mature and gravid proglottids of taenia,, hexacanth and cysticercus larvae of taenia., aschelmtnthes, t.s. of as carl (male and femlu.e), anneuda, t.s. of nereis through different regions,, parapodia of nereis and heteronereis., tro hophore larva., arthropoda:, v.s. of compound eye,, nauplllis, l oea,, megalopa larvae and mysis, mouth parts of insects, head and mouth parts of mosquioeto anapheles, head and mouth part of butterfly, t.s. of shell of la..mellidens,, glochidium larva, echinodermata, t.s.ofarm, tubefeet and pedicel la ria,, bipinnaria larva of starfish,, echlnopluteus larva., . hemichordata :tornerla larva., urochordata-, t.s. through phar ynx show1ng gonads, t.s. through caudal region., pisces, placoid,, cycloid and ctenoid scales, v.s. of skin, amphibia, v.s. of skin,, frog fertilized egg, frog unfertilized egg, frog t.s. of testis,, frog t.s. of kidney, frog-t. s. of liver, reptilia, v.s. of skin and t.s. of stomach., aves, t.s. of inte tine, t.s. of liver, t.s.ofovary, , filoplume w.m ., types of feet and cla ws in birds, mammals, i) t.s. of pancreas,, 2) t.s. of thyroid gland,, 3) l.s . of pltuitar y gland,, 4) t.s. of intestine,, 5) l.s . of kidney,, 6) t.s. of testis and ovary and v.s. of skin, t.s. of lung, embryological slides (individual), chi k embryo: w.m. is hours of incubation, chick embryo: w.m.24 hours of incubation, chick embryo: w.m 36 hours of incubation, chick embryo: w m.72 hours of incubation, chick embryo: w.m.96 hours of incura. tion, frog (disarticulated bones), rabbit bones, fowl bones, v aranus bones, alcohol - ethanol, eosin, xyelne, hemtoxylene, acetocarmin, carnoy's fluid, chloroform, glacial acetic acid, ferric chloride, nacl, sodium citrate, giemsa stain, methylene blue, distilled water, dpx, formaline, toluene,, starch, iodine solution, alcohol - stain- xylene- dpx series bottles, alcohol -st ain-xylene- dpx series stands, slide box, cover slips, alcohol lamps for slide prepara tion, petri dlsh- noj

State Government

CTN :39391119

01 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, acyclovir 3%(ointment),ointment, alfacalcidol 0.25mcg, calcium 200mg (0.25mcg+200mg),capsule, alfuzosin (10mg),tablet /capsule, amantadine (100mg),tablet, amisulpride (50 mg),tablet, anti d immunoglobulin for iv/im use (monoclonal) (150mcg (1ml vial)),injection, anti thymocyte globulin (250mg/5ml),injection, atorvastatin + asprin (10mg + 75mg),tablet or capsule, bisoprolol (5 mg),tablet, busulphan(60mg/10ml),injection, canagliflozin (100 mg),tablet, carbamazepine(100 mg / 5ml 100ml bottle),syrup, chlorthalidone (12.5mg ),tablet, clobetasole propionet 0.05% + salicylic acid 3% (15gm tube),ointment, cyclosporine (100mg),capsule, cyclosporine(100mg/ ml),solution, cyclosporine(50mg),capsule, dacarbazine 200mg (10mg/ml),injection, diclofenac+paracetamol+chlorzoxazone (50mg + 325mg + 250mg),tablet, diloxanide furoate (tablet 500 mg),tablet, etophylline + theophylline sr tablet 231mg + 69mg,tablet, fat emulsion 20% (250ml),injection, ferric carboxymaltose 50mg/ml(20ml vial),injection, fluvoxamine (100mg),tablet, fluvoxamine (50mg),tablet, formoterol 6mcg + budesonide 400mcg (30 cap x 6 pack with 1 dispensing device),rotacaps, gatifloxacin (0.3% ),eye drop, glargine 100 iu /ml, 3ml cartridge inj. (firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost)(100 iu /ml),cartridges, glimepride 2mg + metformin 1000mg (tab),tablet, hepatitis b immunoglobulin (100 iu/vial),vial, human insulin regular/soluble (100iu/ml (10ml vial)),injection, hydrocortisone sodium succinate inj. 200mg vial,injection, hydroquinone 2% + mometasone 0.1% + tretinoin0.025% (5 gm tube),cream, hydroxy propyl methyl cellulose injection 2% (3ml prefilled syringe),syrings, ipratropium bromide inhaler 20mcg per puff (200 metered dose container),inhaler, irinotecan hydrochloride (100mg),injection, labetalol 5mg/ml (4ml ampl),injection, lactulose (10gm/15ml (100 ml bottle)),solution, lamotrigine dt tab (100mg),tablet, levetiracetam 100mg/ml syrup/ solution (100ml bottle),syrup, lorazepam (2 mg),tablet, magnesium sulphate injection (50 % w/v 10ml amp),injection, medroxyprogesterone acetate (injection 150 mg 1ml/vial),injection, moxifloxacin ( 400mg),tablet, nepafenac(1mg/ml),eye drop, nicotine (nrt) (2 mg chewing gum ),gum, nicotine (nrt) (4 mg chewing gum ),gum, pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg(tab)(tablet (with additional content acceptable)),tablet, phenobarbitone (200 mg/ml),injection, potassium chloride 150mg/ml injection, 10ml ampoule (10ml ampoule),injection, pregabalin (75mg),capsule, rabeprazole + levosulpiride (20mg +75mg),tablet or capsule, rifaximin (400mg),tablet, sitagliptin (100mg),tablet, sitagliptin + metformin (50mg + 500mg),tablet, sodium hyaluronate (intraocular) (1% /ml),injection, sorafenib (200mg),tablet, tenecteplase (40mg),injection, tenecteplase 20mg (20mg),injection, teneligliptin (20mg),tablet, thyroxine sodium (75 mcg),tablet, tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg (pack of 180 to 200mdi),inhaler, tiotropium 9mcg 180 doses inhaler (180 or more doses acceptable),inhaler, tricholine citrate + sorbitol (550mg + 7.15 g/10ml ),syrup, vinblastine (10mg),injection, vitamin d3 (800iu/ml),drop, voglibose (0.2 mg),tablet, water for injection 5ml amp

CTN :39498760

26 Mar, 2025 NA

Ganganagar - Rajasthan

Tender For bid to ras bid to ras tender for supply of folic acid 5 mg , formoterol 6 mcg plus budesonide 200 mcg mdi inhaler , formoterol 6 mcg plus budesonide 200 mcg rotacap , formoterol 6 mcg plus budesonide 400 mcg rotacap , framycetin sulphate cream bp 1 percent cream 15 or 20 gm , gabapentin 100 mg tab , gabapentin 300 mg plus methylcobalamin 500 mg tab , gabapentin 300mg tab or cap , gamma benzene hexachloride 1 percent w by v cetrimide 0 point 1 percent w by v in alcoholic solution , gatifloxacin 0 point 3percent plus prednisolone 1 percent 5 ml eye drops , gatifloxacin 0 point 3 percent eye drops bott of 5 ml , gliclazide 30 mg mr tab , gliclazide 40 mg tab , gliclazide 60 mg mr tab , gliclazide 80 mg tab , glimepiride 2mg plus metformin 500 mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glimepiride 1 mg plus metformin 500 mg tab , glimepiride 2 mg plus metformin 1000 mg sr tab , gloves operation size 7 powdered pair of , gloves operation size 6 point 5 powdered pair of , gloves operation size 7 point 5 powdered pair of , glucosamine 250mg plus chondroitin sulphate 200 mg cap or tab , glucosamine 500 mg tab , glucosamine 750 mg plus diacerin 50 mg plus methysuphonylmethanone 200 mg tab , glucosamine 750 mg plus diacerin 50 mg tab , glutathione 50 mg tab , glycerine ip bottle of 100 ml , glyceryl trinitrate 2 point 6 mg tab , gum paint 15 ml tannic acid 2 percent plus zinc chloride 1 percent plus cerimide 0 point 1 percent w by v , heel pad silicon pair of , hydralazine 37 point 5 mg plus isosorbide dinitrate 20 mg tab , hydrochlorothiazide 12 point 5 mg tab , hydrochlorothiazide 25 mg tab , hydroxychloroquine 200 mg tab , hydroxychloroquine 300 mg tab , hydroxyzine 10 mg tab , hydroxyzine 25 mg tab , ibandronic acid 150 mg tab , indapamide sr 1 point 5 mg tab , indomethacin 75 mg sr cap or tab , inh ipratropium bromide 20 mcg plus levosalbutamol 50 mcg 200 mdi , inj denosumab solution 60 mg per ml , inj etophylline 84 point 7 plus theophylline 25 point 3 per ml 2 ml inj , human insulin analogue glargine inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen 3 ml pfp , inj glulisine 100iu per ml 3 ml pfp , inj insulin isophane 70 percent plus human insulin 30 percent 100 iu per ml 3 ml pfs , inj insulin aspart 100iu per ml pen human insulin analogue rapid acting inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen , inj iron ferric carboxymaltose 500 mg 50 mg per ml 10 ml vial for inj , inj iron sucrose 100 mg per 5 ml , inj levocarnitine 500 mg , multi vit inj iv 2 to 10 ml with minimum constituents having thiamine b1 30 mg per ml pyridoxine b6 30 mg per ml and b12 cyanocobalamin 300 mcg per ml , inj pantoprazole 40 mg , inj tetanus toxoid 0.5 ml , insulin syringe disposable 40 iu , isapgol or ispaghula husk 3 point 5 gm sachet , isosorbide 5 mononitrate 30 mg tab , isosorbide dinitrate 10 mg tab , itopride 50 mg tab , itraconazole 100 mg tab , itraconazole 200 mg cap or tab , ivabradine 5 mg tab , ivermectin 6 mg tab , ketoconazole cream 2 percent tube of 30 gm , ketoconazole shampoo , ketorolac 10 mg tab , kit for estimation of alkaline phosphate , kit for estimation of bilirubin , kit for estimation of glucose , kit for estimation of hdl , kit for estimation of triglyceride , kit for estimation of uric acid , knee caps size l pair of , knee caps size m pair of , knee caps size xl pair of , knee caps size xll pair of , lactobacilllus 1 gm sachet , lancet needle , leflunomide 10 mg tab , leflunomide 20 mg tab , levitiracetam sr 500 mg tab , levocarnitine 500 mg tab , levocetrizine 5mg plus montelukast 10 mg tab , levocetrizine 5 mg tab , levosalbutamol 1 point 25 mg plus ipratropium 500 mcg in 2 point 5 ml respule , levosalbutamol 100 mcg plus beclomethasone 100 mcg rotacap , levosulpiride 25 mg tab , lignocaine 5 percent plus gabapentin 6 percent oint tube of 10 gm , lignocaine hcl jelly 2 percent tube of 30 gm with sterile tube and short

CTN :39724420

11 Apr, 2025 70.00 Lacs

Puducherry - Tamil Nadu

Tender For supply of consumables/non-consumables for the department of pharmacology. - chemicals, acetylcholine chloride (ar grade), ammonia (ar grade), ammonium acetate (lc-ms grade) sigma, ammonium thiocyanate acs grade, ammonium thiocyanate ar grade, ascomycin (reference standard powder) sigma, atropine sulphate (ar grade), benzoic acid sigma acs reagent, >99.5% (sigma), bismuth sub nitrate (ar grade), bratton marshall reagent (ar grade), calcium chloride (ar grade) powder, carbamazepine (analytical standard) sigma, chloroform hplc (ar grade), cobalt nitrate (ar grade), concentrated hydrochloric acid (ar grade), concentrated nitric acid (ar grade), cyclosporine a (analytical standard) sigma, dextrose (ar grade) powder, diazepam (analytical standard) (sigma), diclofenac (ar grade), edta (ar grade), ethanol absolute, ferric chloride (ar grade), ferric nitrate (ar grade), formic acid lc/ms grade (98- 100%), glacial acetic acid (hplc grade), isopropyl alcohol (hplc grade), magnesium chloride (ar grade) powder, mercurric chloride (lr grade), morphine sulphate (pure powder), ninhydrin (ar grade), orthophosphoric acid (ar grade), papaverine pure powder (ar grade), phenobarbitone (phenobarbital) (reference standard powder) sigma, phenytoin (reference standard powder) (sigma), potassium chloride (ar grade), potassium dihydrogen orthophosphate (ar grade), potassium hydrogen phosphate (ar grade), potassium hydroxide (ar grade), potassium iodide (ar grade), potassium permanganate (ar grade), pottassium dihydrogen phosphate (ar grade), quality controls for estimating carbamazepine in human serum using uplc, quality controls for estimating cyclosporine in human whole blood using lc-ms, quality controls for estimating phenobarbitone in human serum using uplc, quality controls for estimating phenytoin in human serum using uplc, quality controls for estimating tacrolimus in human whole blood using lc-ms, quality controls for estimating valproic acid in human serum using lc-ms, sodium bicarbonate (ar grade), sodium chloride (ar grade), sodium hydroxide pellets (ar grade), sodium nitrite (ar grade), sodium salicylate powder (ar grade), sodium valproate/valproic acid sodium (reference standard powder) (sigma), strychnine pure powder (ar grade), sulfamic acid (ar grade), sulphuric acid (ar grade), tacrolimus (reference standard powder) (sigma), trichloro acetic acid (ar grade), valproic acid- d6 solution (sigma), zinc sulphate sigma, solvents, acetonitrile hplc grade, acetonitrile lcms grade, ethyl acetate (ar grade), glycerine (ar grade), methanol (ar grade), methanol (hplc grade), methanol (lcms grade), plastic wares, 15ml pp conical bottom tube (tarson) (pack of 20), 50ml pp conical bottom tube (tarson) (pack of 10), centrifuge tube rack (polypropylene) - 15ml capacity (min. 30 places), centrifuge tube rack (polypropylene) - 50ml capacity (min. 10 places), centrifuge tube stand (15 ml capacity) (12x3 holes, aluminium), cuvetes (plastics) 2ml, membrane filter, nylon 0.45 , 47mm (pack of 100), micro tips (200-1000 l) (white) (pack of 1000), microcentrifuge tube (1.5 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microcentrifuge tube (2 ml) with flip cap, sterile, pp (pack of 500) (preferred make; abdos/tarson), microtips (0.2 - 10 ul) (white). (pack of 1000) (preferred make; abdos/tarson), microtips (2 - 200 l) (white). (pack of 1000) (preferred make; abdos/tarson), nitrile gloves (purple, size-large) (pack of 100), nitrile gloves (purple, size-medium) (pack of 100), pasteur pipette - plastic, 3ml sterile (pack of 100), screw capped polypropylene 2 ml storage vials (pack of 100), stir bar, magnetic teflon coated, reusable (8 x 30mm), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 1000ml (borosilicate glass), storage bottles, graduated, clear with pp screw cap and pp pouring ring (blue), autoclavable upto 140 c, size: 100ml (borosilicate glass), storage bottles,

Central Government And Public Sector

CTN :39540988

03 Apr, 2025 21.5 Thousand

Karwar - Karnataka

Tender For corrigendum : supply of chemicals to krims, karwar - ethyl alcohol 500ml for biochemistry (karwr), casien 500grm (karwr), sodium lauryl sulfate 500grm (karwr), methylmalonic acid 25grm (karwr), oxaloacetic acid 5grm (karwr), amido black 10b 100grm (karwr), p- dimethyl benzaldehyde 500grm (karwr), cholesterol 100grm (karwr), four-nitroaniline 250grm (karwr), demthyl amine 500ml (karwr), dimethyl sulphoxide 500ml (karwr), magnesium chloride 500grm (karwr), sodium salicylate 500grm (karwr), phosphotungustic acid 100grm (karwr), o-cresolphthlein complexone 5grm (karwr), succinic acid 500grm (karwr), eight-hydroxy quinoline 100grm (karwr), buffer capsule (karwr), brij (30 percent) 500ml (karwr), one-nitroso-2napthol 25grm (karwr), bromophenol blue 25grm (karwr), agarose medium 25grm (karwr), potassium dihydrogen orthophoshate 500grm (karwr), sodium chloride 500grm (karwr), di- acetyl monoxime 100grm (karwr), uric acid 100grm (karwr), creatinine 100grm (karwr), calcium chloride 500grm (karwr), lead oxide 500grm (karwr), cupric acetate 500grm (karwr), sulphur powder 500grm (karwr), conc .hydrochloric acid 5litrre (karwr), conc sulphuric acid 5litrre (karwr), conc.nitric acid 2.5litre (karwr), trichloro acetic acid 500grm (karwr), tris buffer 500grm (karwr), picric acid 500grm (karwr), thiosemicarbazide 500grm (karwr), tartaric acid 500grm (karwr), sulphosalycilic acid 500grm (karwr), starch 500grm (karwr), sodium dihydrogen orthophosphate 500grm (karwr), sodium pyuruvate 25grm (karwr), sucrose 500grm (karwr), sodium acetate 500grm (karwr), sodium tungustate dihydrate 100grm (karwr), resorcinol 500grm (karwr), phenyl phosphate disodium salt 25grm (karwr), potassium ferricynide 500grm (karwr), potassium sodium tartarate 500grm (karwr), potassium dichromate 500grm (karwr), phenyl hydrazine hydrochloride 500grm (karwr), pottasiun iodide 250gr (karwr), peptone 500grm (karwr), phenol crystals 500grm (karwr), oxalic acid 500grm (karwr), napthol 100grm (karwr), ninhydrine 100grm (karwr), methyl red solution 125ml (karwr), mercuric sulphate 250grm (karwr), molybdic acid 100grm (karwr), magnesium sulphate 500grm (karwr), maltose 500grm (karwr), metol 500grm (karwr), l-alanine 500grm (karwr), l-aspartic acid 100grm (karwr), leadacetate (anhydrous) 500grm (karwr), lactose 500grm (karwr), gelatin powder 500grm (karwr), ferric chloride anhydrous 500ml (karwr), formaldehyde 500ml (karwr), ethylene diamine tetraacetic acid 100grm (karwr), dipottasium oxalate 500grm (karwr), diphenyl amine 100grm (karwr), d- ribose 25grm (karwr), dexrose 500grm (karwr), dinitro phenyl hydrazine 500grm (karwr), d-fructose 500grm (karwr), calcium carbonate 500grm (karwr), coumasssie brilliant blue 25grm (karwr), chromatograph sheets 25units (karwr), chloroform 2.5litre (karwr), butanol 500ml (karwr), bromocresol green 100grm (karwr), barium chloride 500grm (karwr), amino acid kits (24nitem) 2box (karwr), iso-amyl alcohol 500ml (karwr), acetic anhydrous 500ml (karwr), alpha-keto glutaric 25grm (karwr), four-amino antipyrine 100grm (karwr), l-ascorbic acid 500grm (karwr), ammonium persulphate 500grm (karwr), one amino, 2-napthol,4-sulphonic acid 100grm (karwr), maglumi trop-i (karwr), maglumi ck-mb (karwr), fully automated analyser (xl) amylase 5x11ml (karwr), fully automated analyser (xl) d-dimer control( r1-5x1ml, r2- 5x1ml) (karwr), fully automated analyser (xl) ferritin control(1x1ml) (karwr), fully automated analyser (xl) crp control (1x1ml) (karwr), fully automated analyser (xl) ferritin with calibrator (r1- 2x14.5ml ), r2- 2x7.7ml (karwr), fully automated analyser (xl) d-dimer with calibrator( r2-1x4 ml) (karwr), sodium bisulphate 500gm (karwr), benzidine reagent 500ml (karwr), nitric acid 2.5l (karwr), acetone 2.5 l (karwr), sodium sulphite 500gm (karwr), sodium hypobromite 500ml (karwr), silver nitrate 500gm (karwr), sodium bisulphite 500gm (karwr), sodium hydroxide pellets 5 kg (karwr), sodium carbonate 500gm (karwr), glacial acitic acid 500ml (karwr), iodine 1

Central Government And Public Sector

CTN :39416633

27 Mar, 2025 220

Hubli - Karnataka

Tender For corrigendum : supply of lab reagent items & other items - test tubes plastic 5ml (khans) 12x75-, micro pippette tips 200-1000 micro liters (blue colour) 1x1 -, micro pipette tips 20-200 micro liters (yellow colour) 1x1 -, autopipette 5-50 micro mililitre -, autopipette 20micro mililitre fix-, autopipette 10micro mililitre fix-, autopipette 1ml variable-, soft embalming fluid 25 litre-, borosilicate glass filtration flask with inter changeling joint 2000ml capacity-, gold chloride 1 gm -s-, fuschin acid 500gm -s-, edta 100gm -s-, ferric chloride 500gm -s-, ferric ammonium sulphate 500gm -s-, phosphomolybdic acid 500gm -s, aniline blue 25gm -s-, nuclear fast red 25gm -s, aluminium sulphate 500gm -s-, fyrogolic acid 500gm -s-, chromic acid 500gm -s-, ammonium hydroxide 500gm -s-, edta powder disodium salt 100gm -s-, freezing media 100ml(ultra freeze(oct) frozen section compound medium 118ml-, reticulocyte diluting fluid (nice company) 125 ml-, hb strips for biosense machine 1x1 - test, filter paper 100 circles per sheet grade 211 size 46 x 56c1x1--, blotting paper sheet-, leica disposable microtome blades 50x1 pack-, glass slides 75 x 25 mm x 1.45 pack 1x50 nos-, micro glass cover slips (22 x 50mm square x10g) pack size 1 x 1 (20 pices of 10 gm - per box)-, micro glass cover slips (22 x 22mm square x10g) pack size 1 x 1 (20 pices of 10 gm - per box)-, xylene 2.5 ltr-, wrights stain powder 25gm -s-, paraffin wax (block form) congealing point 58-60 c 25kg pack-, generaltion violet 10gm -s, giemsa stain 100ml-, glycerin 500 ml-, glacial acetic acid 500 ml-, formic acid 500 ml-, sol formaldehyde 37 percentage stebilized with 10 percentage preservative methonal 25 ltr can -, ehrlichs reageneralt 125 ml-, dextrose 500gm -s-, drabkins solution 5 ltr-, dpx mountant 500 ml----, benedicts reageneralt 5 ltr-, acetone 2.5 ltr-, acd bags 500ml-, plasma pherisis bag-, plateletpheresis bag-, blood bag penta 450ml 1x1 -bag, blood bag triple 450ml 1x1 -bag, blood bag double 350ml 1x1 -bag, copper suphate powder 500gm -s-, anti d 1gg 10ml -, bovine albumin 22% 5ml-, tris 500gm -s nice , ea 3625gm -s-, sodium chloride 500gm -s-, ammonium chloride 500gm -s, disodium hydrogen orthophosphate 500gm -s, sodium dihydrogen orthophosphate 500gm -s, conc hydrochloric acid 500ml, hematoxyline powder 25gm -s, eosine yellow 500gm -s, light green 25gm -s, phosphotungstic acid 100gm -s, basic carbol fuschin 500gm -s, aluminium ammonium sulphate 500gm -s, ammonium sulphate 500gm -s, biebrich scarlet 50 gm -s, benzidine powder 100gm -s, borax powder 500gm -, lithium carbonate extrapure, 250 gm -., liquor ammonia 500ml--, methanol acetone free (nice) 2.5litre, mercuric oxide 25gm -s, methylene blue 500gm -s, nitric acid 500ml--, nigrosine 100gm -s, oil red o 25gm--, orange g 500gm--, periodic acid 200gm -s, phenol crystals 500gm -s, picric acid 500ml, potassium metabisulfite 500gm -s, potassium ferrocyanide 500gm -s, silver nitrate 25gm -s, sodium nitroprusside 100gm -s, sodium metabisulphate 500gm -s, hexa 500gm -s, turpentine oil 500ml, sulphosalicylic acid 500gm -s, sodium thiosulfate 500gm -s, triethoxysilane(3-aminopropyl) 100gm -s, r.p.r. kits 100 test / kit(rpr) 1x1 -, anti-human globulin 5ml--, anti a1 5ml 1x1 -, anti h 5ml 1x1 -, anti abd 10ml 1x1 -, anti ab 5ml 1x1 -, malaria parasite detection test card 1x1 - test, hiv tridot test kit, 1x1 - test, hiv rapid test kit, 1x1 - test 4th generaleration, hiv elisa test kit 1x96 test 4th generaleration, hcv rapid test kit 1x1 - test 4th generaleration, hcv elisa 1x96 test 4th generaleration-, hbsag rapid test kit 1x1 - test 4th generaleration-, hbsag elisa 1x96 test 4th generaleration-, isopropyl alcohol 25liter can-, sterile plastic dropper pipette with conical tip 1.5ml 110mm in length , urine ketone bodies strips 1x1 -, urine analysis strips(alb+sugar) 1x1 -, sulphuric acid 98% 500ml-, sodium flouride 500gm -, plastic petri dish autoclavable 9cm/10cm-, mmt glass test tube size 12x75-, citrate size glass t

Central Government/Public Sector

CTN :39697545

04 Apr, 2025 NA

Solapur - Maharashtra

Tender For supply of chemicals - natural colour 10000 ul capacity la888 1 x 100no 1 x 100no , freezing bo x es cardboard dim 13.4 x 13.4 x 4.7cm 64 place freezing bo x 2 inch cg289 1 x 10no 1 x 10no , freeze tag white label size 25 x 13 mm 1000 labels pack roll form la938w 1 x 1000no 1 x 1000no , hiindicator ph paper la310 1pk 1pk , cryogenic permanent marker red dual point la697 1no 1no , cryogenic permanent marker black dual point la697a 1no 1no , hicap b18 blue coloured 18 mm od pw024 500no 1 no , hicap b38 blue coloured 38 mm od pw032 500no 1 no , triclogel in 5 lit can pack co155 1no 1 no , hi pette autopipette stand made with acrylic sheet 9 pipette holding capacity with tip bo x la632 1no 1 no , pikovskayas broth medium granulated gm1719 500g 500gm , aleksandrow broth m1997 500g 500gm , zinc solubilizing medium m2023 500g 500gm , 100bp dna ladder mbt049 200ln 200ln 4 x 200 ul , 2 x pcr taq mi x ture mbt061 100r 100r 2.5 ml , 50 x tae ml016 500ml 2 x 500 ml , syringe driven filters sf144 2 x 50no 2 x 50 no. , syringe driven filters sf143 2 x 50no 2 x 50 no. , petroleum ether 60 to 80 degree c hi ar as065 2.5l 2.5 liter , quantitative filter paper 0740 1250 100c , freeze tag la940w 1 x 1000no , l proline pct0317 25g 25 gm , polygalacturonic acid rm4779 5g 5 gm , orthophosphoric acid abt 88 percent hi ar as011 500ml 500 ml , hydrochloric acid abt 35 percent pure hi ar as004 2.5l 2.5 liter , ferrous ammonium sulphate he x ahydrate hi ar acs grm3887 500g 500 gm , potassium dihydrogen phosphate for hplc grm2951 250g 250 gm , diphenylamine hi ar acs grm520 250g 250 gm , paraffin liquid heavy grm6362 500ml 500 ml , paclobutrazol pct0828 25g 25 gm , buffer solution ph 4.0 plus or minus 0.02 ml061 500ml 500 ml , buffer solution ph 7.0 plus or minus 0.02 ml062 500ml 500 ml , buffer solution ph 9.2 plus or minus 0.02 ml063 500ml 500 ml , starch soluble hi ar acs grm3029 500g 500g , gluten hydrolysate maize rm6406 500g 500g , pectin grm396 500g 500g , guar gum powder grm1233 500g 500g , glycerol 85 percent as100 1l 1l , tween 80 lq520 x 25 x 10ml 25 x 10ml , gelatin type a mb169 500g 500gm , 2 4 6 tri2 pyridyl s triazine rm1487 1g 1 g , ferric chloride anhydrous tc583 5g 5 g , 2 2 diphenyl 1 picrylhydrazyl rm2798 1g 1 g , chitosan from shrimp shells grm9358 100g 100 g , sodium borohydride hi ar acs grm10345 100g 100 g , phenol reagent hi lr rm10822 100ml 100 ml , clear ph buffer solutions 480 ml bottleph 4.01 ecbu4bt 480 ml , clear ph buffer solutions 480 ml bottleph 7.00 ecbu7bt 480 ml , clear ph buffer solutions 480 ml bottleph 9.00 ecbu9bt 480 ml , hiindicator ph paper la335 1pk 1 pk , nutrient broth m002 500g 500 g , potato de x trose broth granulated gm403 500g 500 g , agar powder bacteriological grade grm026p 500g 500 g , autoclavable petri plates pw008 1 x 100no 1 x 100no , freeze tag la939w 1 x 1000no 1 x 1000no , parafilm d m250 la017 1no 1 no , s.s test tube racks la222 1no 1 no , hiclean liquid soap as023 5l 5 l , hidispo bag 14 pw038 250no 250 nos. , syringe driven filters pvdf hydrophilic membrane pore size 0.22 um 25 mm diameter with prefilter non sterile sf130 1 x 250no 1no. , sulfuric acid pure hi ar as016 500ml 500 ml , perchloric acid about 70 percent hi ar acs as013 500ml 500 ml , sodium hydro x ide pellets hi ar acs grm467 500g 500 g , methanol hi ar as059 2.5l 2.5 l , hydrochloric acid abt.35 percent pure hi ar as004 500ml 500 ml , citric acid anhydrous mb174 500g 500 g , amylase from malt grm638 500g 500 g , nutrient agar bid details/ 2 / 103 medium mm012 500g 500 g , potato de x trose agar mh096 500g 500 g , lactobacillus mrs agar mrs agar m641 100g 100 g , phytawrap pla002 1 x 10no 10 no , hi fle x iloop 2 pw012 5 x 100no 5 100no , mueller hinton agar m173 500g 500 g , potassium carbonate anhydrous hi ar grm731 500g 500 g , sodium benzoate hi ar grm1260 500g 500 g , sodium starch glycolate hi lr grm7519 500g 500 g , acetone hi ar as025 500ml 500ml , 0.1 percent peptone water lq172c 5 x 100ml 5 100ml , triclogel dispense

Sulphur Trioxide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Corporations And Associations And Others

State Government

Central Government And Public Sector

Central Government And Public Sector

Central Government/Public Sector