Latest titanium oxide Tenders | Government titanium oxide Tenders

State Government

CTN :39200933

19 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39741148

10 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For corrigendum : lab equipment and other during /2024-25 - group 1 - chemicals and disinfectants, phenol crystals (carbolic acid) 500gm, sulphuric acid 500ml, sodium hypochlorite 5 liter, methylene blue 25gm, potassium dichromate, basic fuchsin 25gm, immersion oil heavy grade liquid paraffin 30ml, sodium hydroxide pellets 500gm, tri sodium citrate 500gm, disodium hydrogen phosphate 500gm, potassium dihydrogen phosphate (anhydrous) 500gm, n-acetyl-l cystein 100gm or 250gm, potassium permanganate (kmno4) 500gm, formaldehyde 500ml, magnesium sulphate 500gm, magnesium citrate (tribasic) 500gm, asparagine 500gm, malachite green 500gm, glycerol 500ml, para nitro benzoic acid- 500ml, sodium chloride 500gm, brain heart infusion agar 500gm, sodium carbonate 500gm, oxalic acid 500gm, auramine o 25gm, hydrochloric acid 500ml, immunochromatographic test (rapid identificationtest) for mtb 1x25 kit, group 3- personal protective equipment (ppe), latex gloves (size- small) 100nos, latex gloves (size- medium) 100nos, latex gloves (size- large) 100nos, laboratory coats (size- small) 01nos, laboratory coats (size-medium) 01nos, laboratory coats (size-large) 01nos, surgical gowns (size- small) 01nos, surgical gowns (size- medium) 01nos, surgical gowns (size- large) 01nos, group 4a - pipettes tips for phenotypic use, 1-200 l pipette tips 1x96 tips, 20-200 l pipette tips 1x96 ", 100-1000 l pipette tips 1x96 ", 100-1000 l pipette tips (long tip) 1x96 ", pasteur pipettes (sterile individually packed), group 4b - pipettes tips for molecular use, 1-10 l pipette tips 1x96, 1-20 l pipette tips 1x96, 1-200 l pipette tips 1x96 tips, 20-200 l pipette tips 1x96, 10-100 l pipette tips 1x96, 100-1000 l pipette tips 1x96, pasteur pipettes 1x96, group 4b - pipettes tips for molecular use, culture tubes or universal glass bottles (mccartney bottles) 50ml (1 x 100) or (1 x 50), slides 10 kit (50 slides), glass ware flat bottom flask -1 lit, glass ware for stain preparation measuring cylinder - graduated 100 ml, measuring cylinder-graduated 500 ml, measuring cylinder-graduated 1000 ml, glass stoppered bottles -250 ml, container for stain -250 ml polyethylene, flat bottom flask - 5 lit, flat bottom flask - 1 lit, glass beaker- 500ml, glass beaker- 250ml, glass beads (5 mm), beaker- 250 ml, beaker- 100 ml, beaker- 500 ml, beaker- 1000 ml, funnels - 5 cm diameter, funnels - 10cm diameter, funnels - 18cm diameter, volumetric flask - 100 ml, volumetric flask - 1000 ml, 2 lit bottle- amber colour, 1 lit reagent bottle transparent, 500 ml reagent bottle- transparent, 250 ml. reagent bottle- transparent, group 6- disposable items, 50 ml polypropylene (pp) tubes for centrifuge (sterile), 15 ml polypropylene (pp) tubes for centrifuge (sterile), micro-centrifuge tube, sterile with cap, 1.5 ml, na, cryo-vial, sterile with cap, 2 ml (for long term storage), cryo vial storage boxes (1 x 50), cryotag 1 x 1000 per, bags for waste bin 60 litres, bags for waste bin 30 litres, bags for waste bin- 2 litres, single use syringes, sterile- 10 ml 50pcs, na, syringe filter (0.22um) for single use, sterile, filter paper sheets (for work benches) 100 sheet, single-use paper towels 100nos, tissue rolls, 2 ml standard reaction tube, pcr tubes (0.2 ml), forceps, individually wrap, sterile 50nos, petri dishes (plastic) 20per kg, disposable loops 10 l, group 7- general lab items, loop holders 1nos, loop wire 1nos, loop wire 1nos, inoculation loops 4mm 1nos, inoculation loops 3mm 1nos, diamond marker pencil 1 x 6", cotton .5kg, filter paper (for sputum microscopy reagents), stainless steel tray, perforated baskets 1 nos, wire rack, discard bucket with lid (10l), discard bins (2l), forceps (stainless steel) 1 x 6", stainless steel scissors 1 x 6", spatula 1 nos, boxes (for holding petri dishes), stainless steel trays, stainless steel funnel 1 nos, drying racks 1nos, brown paper 1 nos, rubber bands, cotton thread 1 x10 rolls, wire racks to hold mccartney bottles 1 nos, stainless steel rods for staining

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

Central Government/Public Sector

CTN :39934090

17 Apr, 2025 NA

Delhi - Delhi

Tender For supply of a m i no- 18.115/2025-26 syrup containing calcium carbonate 250mg, magnesium 25m g, zinc 1.25mg and cholecalciferol 125iu per 5ml in 200ml bottle ]

Central Government/Public Sector

CTN :39572479

10 Apr, 2025 NA

Guna - Madhya Pradesh

Tender For corrigendum : supply of lab chemical - buffer solution ph 9.18 details specification shall be as per attached nit , magnesium standard crm 1000 mg details specification shall be as per attached nit , standard total kjeldahl nitrogen 1000mg details specification shall be as per attached nit , potassium chloride crm details specification shall be as per attached nit , potassium dichromate crm details specification shall be as per attached nit , sodium carbonate crm details specification shall be as per attached nit , silica standard nist details specification shall be as per attached nit , turbidity standard crm details specification shall be as per attached nit

State Government

CTN :39887239

21 Apr, 2025 NA

Yavatmal - Maharashtra

Tender For tender for supply of medicines and consumables for the year 2024-25 and 2025-26 - tab. cetrizine hydrochloride 10mg, syp. cetrizine 5mg/5ml 30ml, inj. pheniramine maleate22.75mg/2ml, iron folic acid liquid 200ml, tab. folic acid 5mg, inj. atropine0.6mg/mlsulphare 1ml, cap. amoxycillin 250mg, cap. amoxycillin 500mg, syp. amoxycillin+ clavulanic acid dry syp. 200mg+28.5mg /5ml 30ml bottle, tab. amoxycillin+clavulanic acid 250+125mg, tab. amoxycillin+clavulanic acid 500+125mg, tab. cefixime 200mg, inj. ceftriaxone 500mg vial, inj. ceftriaxone 1gm vial, cap. doxycycilline 100mg, inj. gentamycin 40mg/2ml, tab. ciprofloxacin 250mg, tab. ciprofloxacin 500mg, tab. azithromycine 500mg, syp. azithromycin 200mg/5ml15ml, tab. ofloxacin 200mg, tab. metronidazole 200mg, tab. metronidazole 400mg, syp. metronidazole 60ml, i.v. metronidazole 100ml, tab. tinidazole 300mg, tab. metformin 500mg, tab. glimiperide 2mg, oral rehydration salt powder who farmula 20.5gms, tab. ondansetran 4mg, inj. ondansetran 2mg/ml 2ml amp, tab. flucanozole 150mg, tab. glimiperide 1mg, tab. telmistran 40mgs, tab. amlodepine 5mg, tab. atenolol 25mg, tab. atenolol 50mg, syp. antacid 170ml, cap. omeprazole 20mg, inj. pantoprazole 40mg/10ml, tab. acetyl salicylic acid 75 mg ip (aspirin ), tab. dicyclomine hydrochloride 10mg, inj. dicyclomine hcl 10mg/ 2ml, sodium hypochloride solution 200ml, sodium hypochlorite solution 5000 ml, syp. lactulose 667mg/ml 100ml, inj. paracetamol 150mg/2ml amp, paracetamol drop 150mg/ml 15ml, tab. paracetamol 500mg, syp. paracetamol 250mg/5 ml /60ml, inj. diclofenac sodium 25mg/ml/3ml amp, tab. diclofenac sodium 50 mg, diclofenac gel 30gm 1%, syp. ibuprofen 100mg/5ml 60ml, tab. calcium carbonate+vit d3 1.25gm, syp. calcium 200ml, inj. oxytocin 5iu 1ml, tab. salbutamal 4mgs, syp. cough expt. 100ml, i.v. normal saline 0.9% 100ml, i.v. n.s. 500ml, i.v. dextrose 5% 500ml, i.v. ringer lactate 500ml, sterile water for injection 5ml, inj . dexamethasone 4mg/2ml, dexamethasone tab., i.v. dextrose with normal saline 5% 500ml., surgical spirit 500ml, tincture benzoin bottle 500ml, povidone iodine ointment 5% 15gm, clotrimazole cream 1% 15gm, miconazole cream 2% 15 gm ip, anti rabies vaccine im (human tissue culture) 0.5ml, anti rabies vaccine id (human tissue culture) 0.5ml, tetanus toxoid 40 adsorbed 41i.p., tab. vit-b-complex nfi, tab. ascorbic acid 500mg, sterile water for injection 10ml, i.v. ciprofloxacin 200mg/100ml, tab. azithromycin 250mg, ferric carboxy maltose 500mg inj., syp. ondansetran 2mg/5ml 30ml, inj. promethazine 25mg/2ml, inj. pentazocine 1ml, povidone iodine solution scrub 7. 5% 500ml, tab. ifa (60 mg + folic acid 500 mcg (wifs) blue coloured tablet, iron folic acid syrup with auto dispenser 5o ml bottle, tab. ifa containing 45 mg elemetal iron & 400 mcg folic acid pink tab, tab. folic acid 400 mcg, inj. iron sucrose 50mg in 2.5ml amp, fluconazole oint. tube 15gm, ciprofloxacin eye/ear drop, trimethoprim + sulphamethoxazole susp., pantoprazole tab., ciprofloxacin + dexamethasone eye drops, inj magnesium sulphate 50% w/v, antiscorpion venum serum inj, cholecalciferol 60000 iu granules sachet, hydrogen peroxide ip, ferrous fumarate syrup, vitamin a capsule, vitamin a concetrated solution, clotrimazole lotion, benzyl benzoate lotion, chloramphenicol eye applicaps, syrup furazolidone, etofylline + theophylline inj, diazepam inj., amoxycillin syrup, tab. etophyllin + theophyillin sr, isosorbide dinitrate tab, metoclopramide tab, sodium bicarbonate inj., adrenaline lnj. lmg/ml, prednisolone tab, povidone iodine solution, lignocaine hci i.p inj., antisnake venom serum strerile powder with strerile water, lyophilized sterile solution 10ml, frusemide inj., moxifloxacin eye drop, povidone mouth gargle 2%, trimethoprim + sulphamethoxazole ss tab., furazolidone tab, iron+ folic acid tab 130 mg of elemental iron+ folic acid 250mcg), albendazole tab, albendazole susp., ibuprofen tab.400 mg, ibuprofen tab.200 mg, cefotaxime inj 500 mg, amikaci

CTN :39870162

15 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liquid form

CTN :39850456

11 Apr, 2025 NA

Saharsa - Bihar

Tender For purchase and installation of practical equipment in various educational institutions under saharsa district - moving coil galvanometer , moving coil voltmeter , moving coil ammeter , micro ammeter , sonometer , apparatus to determine relationship between the frequency and tension, length & mass , battery eliminator , tunning fork electrically , apparatus to investigate standing waves on a string. , meter bridge , experiment to determine the unknown resistance of a conductor. , potentiometer experiments to measure the internal resistance of a cell. , deflection magnetometer experiments to measure the deflection of a compass needle by magnetic field , tangent galvanometer apparatus for measurement of the direction & power of current , dry cell , analytical digital weighing scale , bar magnate 50mm, m name , u magnate , mirror fl 4 concave 50mm , mirror convex 50mm , mercury thermometer c/f/r , micrometer screw gauge 15mm , apparatus to measure the dimensions of object with high precision. , eliminator 4amp , meter bridge 100cm long , friction apparatus , dcc copper wire insulated , glass slab 75x50x18mm , lenses concave 50mm , lenses convex 50mm , measuring cylinder 500ml poly to measure the volume of liquid , double disc spherometer , apparatus curvature to measurement of radius of , vernier calipers apparatus to studying expansion of material, charts of newton's second law , charts of ohms law , charts of electro magnate , charts of telescope , charts of reflection of light , charts of refraction of light , charts of newton's law of motion , charts of 4 stroke engine , charts of electron microscope , charts of magnate , mirror stand metallic adjustable , pin stand adjustable metallic , tripod stand , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , rheostat , apparatus to variable change of resistance , lechlanche cell , stop clock , equilateral glass prism 50mm , magnetic compass both side glass , zinc plate with terminal , copper plate with terminals , zinc rod with terminal , manganine coil resistance box 100.ohms , magnesium metal ribbon coil, analytical digital weighing scale , test tube stand , holder hold for glass wares , burette clamp , tripod stand to support glassware , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , gas jar with cover 6x2 , conical flask 250ml , round bottom flask 250ml , flat bottom flask 250ml , reagent bottle 250ml poly , reagent bottle 500ml poly , wash bottle 250ml , test tube 5x1/8 , measuring flask 250ml , pipette 10ml , filter paper 100.circle 12.5 cm dia. whatsman's , test tube holder, tongs , test tube brush , spirit lamp , spatula , conical funnel 75mm , digital conductivity meter , chemical weight box , desiccators with lid glass , atomic model sets , bunsen burner , motor & pestle(porcelain)-3" , beehive shelves(porcelain)-3" , crucible with lid , red litmus paper , blue litmus paper, chart of hydrogen gas , structure of atom , chemical bonding , manufacturing of soap , rutherford atomic model , charts of water purification , charts of bleaching powder manufacturing , charts of nuclear energy , charts of petroleum , sodium hydroxide , phenolphthalein indicator solution , methyl orange indicator solution , sodium carbonate , sodium bicarbonate , calcium chloride , calcium carbonate , ferrous sulphate , blue litmus paper , red litmus paper, compound microscope , apparatus for viewing samples at high magnification. , dissecting microscope , low power microscope , staining rack , empty jar specimens with cover , mounting slides , cavity slides , beaker 500ml pp , beaker 250ml pp , conical flask 250ml borosilicate , conical flask 500ml borosilicate , wash bottle poly 250ml , f.b. flask 250ml borosilicate , test tube borosilicate 150x25mm , measuring cylinder poly 250ml , reagent bottler 250ml poly , petri dish , watch glass 75mm , cover slip , ph paper , test tube stand, charts: human skeleton system , , human nervous system , human hea

CTN :39846983

17 Apr, 2025 NA

Belgaum - Karnataka

Tender For supply of drug and medicine - chlordiazepoxide 10mg tab , doxepin 25 mg cap , clomipramine hcl 25 mg tab , clozapine 100 mg tab , duloxetine 20 mg tab , doxepin hcl 75 mg cap , fluoxetine hcl 20 mg cap , haloperidol 5 mg tab , lorazepam 1 mg tab , lithium carbonate 300 mg cap tab , clonazepam 0 point 25 mg tab , clozapine 25 mg tab , desvenlafaxine 50 mg tab , etizolam 0 point 5 mg tab , risperidone 2 mg tab , aripiprazole 10 mg tab , atomoxetime 10 mg tab , olanzapine 10 mg tab , venlafaxine 75 mg tab , sertraline 50 mg tab , zolpidem 10 mg tab , quetiapine 50 mg tab , paroxetine xr 12 point 5 tab , tab amisulpride 200 mg , quetiapine 25 mg tab , sertraline 100 mg tab , glycopyrronium 25 mcg smartules , etophylline bp 84 point 7mg theophylline 25 point 3 per ml 2 ml inj , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per cfc free mdi , cap nintedanib 150 mg , cap nintedanib 100 mg , levosalbutamol sulphate 2 point 5 ml containing 1 point 25 mg respule , tiotropium bromide 9 mcg 120 metered doses unit inhaler , tiotropium bromide 18 mcg formoterol 12 mcg dry powder cap , budesonide 200 mcg dry powder , formoterol 12 mcg fluticasone 250 mcg dry powder , tiotropium bromide 18 mcg dry powder cap , terbutaline 1 point 25 mg bromhexine 4 mg guaiphenesin 50 mg per 5 ml bott 100 ml syp , dextrose 5 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , sterile water for amp of 10 ml , tab cap mirabegron 25 mg , silodosin 4 mg tab , anti phlebitis cream tube of 15g 20g , povidone iodine 10 percent solution bott of 100 ml , enteral feed pdr protein 85 peptides 15 fat 50 mct 25 85 15 50 25 percent sachet 126 gm , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , tolteridone tartrate 2 mg tab , drotaverine hcl 40 mg tab , finasteride 5 mg tab , vitamin b complex vit b1 5mg vit b6 3mg vit b12 5mcg therapeutic tabcap , vitamin b 12 500 mcg ml inj , iron syp paediatric 5 ml elemental iron 25 50 mg folic acid 500mcg bottle of 200ml , multi vit inj iv thiamine 30mgml pyridoxine 30mg ml cyanocobalamin 300 mcgml 2 to 10ml , dapaglifozin 5 mg tab , fluticasone propionate inhaler for adults 125 mcg dose , salmetrol 50mcg fluticasone 250mcg pdr 30 60 100 doses pdr inhaler , colchicine 0 point 5mg tab , capsacain gel tube of 20 gm , glucosamine 250mg chondroitin sulphate 200 mg cap , ibuprofen gel tube of 20 gm , leflunomide 10 mg tab , nimesulide gel tube of 20 gm , methylprednisolone 4 mg tab , clindamycin 300 mg cap , sulphamethoxazole 400 mg trimethoprim 80mg tab , acyclovir 200 mg tab , emtricitabine 200 mg tenofovir 300mg tab , lamivudine 150 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300mg lamivudine 150mg nevirapine 200mg tab , nitrofurantoin 100 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5mg tab , carvedilol 6 point 25 mg tab , olmesartan 20 mg tab , propanolol 10 mg tab , trimetazidine mr 35 mg tab , gliclazide 40 mg tab , voglibose 0 pont 3 mg tab , tab ornidazole 500 mg , tenofovir 300 emtricitabine 200mg efavirenz 600mg tab , hepatitis b vaccine 10 ml , cell culture rabies vaccine vial of 1 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml , syp iron with vitamin b12 and folic acid bott of 200 ml , syp lactulose each 5ml containing 3 point 325g bott of 200ml , syp liquid paraffin 1 pont 25 magnesium hcl 3 point 75 sodium picosulphate 200 ml bott , syp multivitamin multiminerals bott of 200 ml

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Titanium Oxide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector

State Government

Central Government/Public Sector