Latest windscreen Tenders | Government windscreen Tenders

CTN :39846625

17 Apr, 2025 NA

Visakhapatnam - Andhra Pradesh

Tender For tender for supply of oil return check val , elbow , elbow , elbow , thermo expansion valve , compressor ac 5h120 , 1/4inch flare nut long neck , valve discharge guide assy , aux. contactor 110v a.c. , piston pin 1inch dia , valve plate 5h , crankcase heater 6inch long200 watts-2 , hex bolt m8x1x30 , filter oil screen , oil filter cartridge 5h120 , tube assembly oil filter screen , filter felt , valve suction shut off 2 5/8inch o.d.s. , piston 5h40 , suc valve disc 5h , pe brg washer 5h40 , sleeve unloader , seal cover plate , gasket plate cover , nut connecting rod nyloc nut , element power assy unloader , lub oil filter , gasket set , snap ring , sleeve cylinder , pin valve lifter , washer bearing pump end , discharge valve spring , package oil pump , bush piston pin , crank shaft assembly 5f30 , zinc protector assy , pressure gauge 2 1-2inch (0-300) , thermo expansion valve , angle valve , s v spring 5h , dis valv guide assy , seal end thrust washer , oil impeller , filter felt , seal replacement assy(auth- dcpro(e) mopr(b)/ema 3056-9 , strainer suction assy , bearing main for pump end , chiller , condenser , gasket set , dowel pin 1/4diax1/2lt , seal shaft assy , carbon washer , piston , diff. oil pressure cutout 3 to 4k , sh126 c shaft m/c duly sursulf (590 , crank shaft 5h-126 , solonoid valve 2 1-8 ma4253 sporlan , thermostat , filter drier cachall , cylinder head gasket , rubber tyre for drivecoupling drg.n , oil filter screen , valve solenoid 2 1-8

Central Government/Public Sector

CTN :39606315

01 Apr, 2025 78.21 Lacs

Surguja - Chhattisgarh

Tender For corrigendum : supply of track roller assly, part no. 1027c050000005 , cable real valve assy., part no. 250c050000011 , slip ring and brush holder assy., part no.250m000000134 , pressure reducing valve, part no.611a050000004 , hydraulic fan motor, part no.611b050000076 , hydraulic motor conveyor, part no.811a050000151 , traction valve, part no.611b050000106 , lift cylender, part no.811b050000198 , suction stainer, part no.625b050000122 , flight bar and link assy, part no. 811b070000456 , filter element, pat no. eea0003479 , carbon brush, part no.250a00034003 , chain 1 inch pitch 250a050000031, part no.250a050000031 , pilot valve 4 section, part no.611b050000107 , hydraulic fan motor,part no.613a000000332 , unloading valve sequence valve,part no.625a000003070 , pillow block bearing, part no.811a050000143 , hydraulic pump,part no.811b050000101 , drive line middle,part no.811b050000128 , drive line rear, part no.811b050000130 , drive liner,part no.811b050000136 , twin cooler,part no.811c050000102 , transmission,part no.811c050000116 , spider assy,part no.811m100000417 , hydraulic motor,part no.912b050000121 , clutch inner disc,part no.eea0005787 , clutch outer disc,part no.eea0005788 , seal clutch piston outer,part no.eea0005790 , seal clutch piston inner,part no.eea0005791 , clutch piston assly,part no.eea0010878 , clutch piston assly,part no.eea0010879 , kit drive plate,part no.eea0010872 , seal kit,part no.eea0019109 , seal kit for accumlator 1 litter,part no.eea0019110 , seal kit,part no.eea0020815 , seal kit,part no.eea0020978 , charging pump,part no.eea0010924 , roller,part no.811a0500000103 , roller,part no.811a0500000104 , shaft seal,part no.eea0005646 , axle bolt,part no.912a060000170 , axle bolt,part no.912a060000171

corporations/Associations/Others

CTN :39846603

21 Apr, 2025 6.65 Crore

Ahmedabad - Gujarat

Tender For tender for supply of brake liner and clutch facing rc 2 - clutch disc facing kit 380 dia consist-ceramic facing , rivet (for clutch , tata 1618/62 bs-iv) , 352 dia. clutch disc facing kit- consist of facing ceramic 12-nos , facing rivets 12-nos. (for clutch assy. tata 1512/55 , 1618/62 bs-iii & 1515/55 bs-iv) , disc facing kit-352 dia organic (for clutch facing , tata 1515/55 bs-iv 10mtr) , clutch facing without rivet (for ley 4/185 , 4/186 , 4/169 , 4/170 bs-iii & vk 1611.d4r (10 mtr) 4/197 (12 mtr) bs-iv) , withdraw plate (for clutch , ley 4/185 , 4/186 bs-iii & 1611 bs-iv) , aluminium rivet (per clutch facing rivet qty.- 40 nos) (for ley 4/185 , 4/186 , 4/169 , 4/170 bs-iii & vk 1611.d4r(10mtr) 4/197(12mtr) bs-iv) (1-set 40 nos.) , brake lining kit (std) 394x200 af3838j bs6 with rivets (frt axle for 1618/57 , 1618/62 bs-vi) , brake lining kit(os1) 394x200 af3838j bs6 with rivets (frt axle for 1618/57 , 1618/62 bs-vi) , brake lining kit (std) 394x200 af3838j bs6 (rear axle for 1618/57 , 1618/62 bs vi and front & rear axle for tata 1618/57 , 1618/62 obd-ii bs vi) , kit lining set front-std (set of 4) without rivets (for front axle tata 1515/55 , 1618/62 bs-iv) , kit lining set front -o/s-1 (set of 4) without rivets (for front axle tata 1515/55 , 1618/62 bs-iv) , kit-lining set rear-std (set of-4) without rivets (for rear wheel brake , tata 1618/62 bs-iii & 1515/55 , 1618/62 bs-iv) (2- set per veh.) , kit lining set rear consist 4-pcs o/s-i without rivets (for rear brake tata 1618/62 bs-iii &1618/62 , 1515/55 bs-iv) , brake lining set (std) front & rear set consisting 4-pcs (for tata mini ultra bs-iv , application on veh.reg. no. z 5441 to z-5902) , brake lining set (os/1) front & rear set consisting 4 pcs (for mini ultra bs-iv (application on veh. reg. no. z-5441 to z-5902) , brake lining set (std) front & rear set consisting 4-pcs (for tata 712 , mini ultra bs-iii & bs-iv , application on veh. reg. no. z-0722 to z- 3671) , brake lining set (os/1) front & rear set consisting 4 pcs (for tata 712 , mini ultra bs-iii & bs-iv , application on veh. reg. no. z-0722 to z- 3671) , aluminum rivets 24 nos. (for front & rear brake , tata 1512/55 , 1618/62 bs-iii & bs-iv) , rear brake lining kit with rivet (std) (for rear brake ley 4/197 bs-iv) , rear brake lining kit with rivet (os-1) (for rear brake ley 4/197 bs-iv) , brake lining kit-325 x 140-std consisting of lining 2 , rivet 40 (for front & rear axle , ley mini ls1508.7t6r bs-vi) 4-kit per veh. , brake lining kit - 325x140-s2 comprises of lining 2 , rivet 40 (for frt & rr axle , ley mini ls1508.7t6r bs-vi) 4-kit per veh. , kit lining set (std lining machining 4 nos. without rivets (front brake for ley vk 2011.4t6r , tf2012.otgr bs-vi & obd-ii bs-vi , kit lining set i / os lining machining 4 nos. without rivets. front brake for ley vk 2011.4t6r , tf 2012.otgr bs-vi & obd-ii bs-vi , kit lining set-std lining 4-nos. without rivets (rear brake for ley vk2011.4t6r , tf2012.otgr bs-vi & obd-ii bs-vi) , kit lining set-1 o/s lining 4-nos. without rivet (rear brake for ley vk 2011.4t6r , tf 2012.otgr bs-vi & obd-ii bs-vi) , aluminium rivet set (consisting 40 nos. rivets) (frt/rr brake for 4/185 , 4/186 , 4/169 , 4/170 bs-iii & vk1611 , 4/197 bs-iv & vk2011.4t6r , tf2012.otgr bs-vi & vk2011.4t6r , tf2012.otgr obd-ii bs-vi) , brake lining set (std) front & rear set consisting 4 pcs with rivet (for eicher mini pro3008 bs-iii & pro 3009h3l bus bs vi) , brake lining set (os/1) front & rear set consisting 4 pcs with rivet (for eicher mini pro3008 bs-iii & pro 3009h3l bus bs vi) , brake lining set (std) front & rear set consisting 4 pcs with rivet (for eicher mini pro 3008 bs-iv) , brake lining set (os/1) front & rear set consisting 4 pcs with rivet (for eicher mini pro 3008 bs-iv)

Central Government/Public Sector

CTN :39846548

07 Apr, 2025 17.73 Lacs

Angul - Odisha

Tender For supply of fluid coupling t 12 07 and spares of t 12 12 06 and 07 - fluid coupling complete t-12 07 part no- t1207 , fusible plug with o ring part no- t12121112 , base plug part no- t121210 , flexible disk part no- t121218 , fx nut bolt and washer part no- t1212202122 , repair kit for fluid coupling t-12-12 part no- t121230323948 , coller bolt nut and washer part no- t1212404142 , driving bolt nut and washer part no- t121243444546 , driving plate part no- 5 , fusible plug part no- t120611 , plug o ring part no- t120612 , fxi part no- t120617 , flexible disc part no- t120618 , fx bolt nut and washer for fluid coupling part no- 202122 , repair kit for fluid coupling t-12-06 part no- 30323948 , driving plate for fluid coupling t-12-07 part no- t12075 , base plug part no- t120710 , fusible plug part no- t120711 , plug o ring part no- t120712 , flexible disc for fluid coupling t-12-07 part no- t120718 , spherical bush for fluid coupling t-12-0 part no- t120719 , fx nut bolt and washer part no- t1207212223 , fxo nut bolt and washer part no- t120740 , repair kit t-12 or 07 part no- t120730323948 , is bolt and washer part no- t12075051

CTN :39835449

16 Apr, 2025 31.0 Thousand

Ganganagar - Rajasthan

Tender For supply of pump water , cross disc , clutch plate , hub seal , cross universal joint

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39826792

11 Apr, 2025 1.10 Crore

Bangalore - Karnataka

Tender For front windscreen glass for hst project

CTN :39835278

16 Apr, 2025 NA

Ernakulam - Kerala

Tender For tender for supply of reciprocating pump spares - plate protction , seal mech , lobe liner , plate protn cover , plate protn casing , liner casing , bush sh , oring cover , oring rh bush , o-ring sh bush , ring inner , ring inner , bush rh , bush sh , plate prot , seal lip , seal lip , sleeve shaft , disc cover , base clamp , wedge clamp , wedge clamp , seal lip s15022 , rotor , seal lip , screw cap hex

CTN :39834887

16 Apr, 2025 NA

Allahabad - Uttar Pradesh

Tender For tender for supply of element assy ( inner) , valve evacuator , hose feed pump valve port 3 , bolt joint , v belt ( c x 72) , centrifugal oil filter assy , o ring housing , crankshaft , screw , clamp , pipe , exhause , bolt , hose , hose , seal , pump , fuel injection (mico) , cartidge , cartridge fuel filter , nipple , valve assy , solenoidswitch (37s) , drive assembly , turbocharger assy(tel) , thermostat , hose , water separator , bushing rubber , bolt , knob , governor assy , bearing , disc , screw , nut , rod , strainer , strainer , valve drain , hose , cap assy (vandalism) , o ring , seal oil , o ring , strainer , hose , hose , hose , o ring , gasket , screen , disc , plate , lock , guide , coller , seal oil , gasket , ring snap , lock , cover , o ring , gasket , knob , knob , hose , hose , hose , clamp , clamp , universal joint assy , tube , o ring , o ring , seal oil , seal , o ring , o ring , key , gear (driven forward) , gear driven reverse , gear (driven reverse) , gear coupling (5m) , gear coupling (6mm) , collar , bushing , spacer , bearing roller , plunger interlock , seal oil , gasket , key , cover , bearing needle , lever change , seal oil , o ring , seal ring assy , seal ring assy , o ring , o ring , bolt , ring seal , ring seal , nut , bolt reamer , bearing taper roller , tube , ring seal , disc , seal bearing , spring , rod , pin , lining brake , seal bearing , spring , spring , bearing , tube , tube , magnet , screen , o ring , o ring , hose , hose , hose , clamp , clamp , seal , cover lh , seat grease filler , seal , gasket , gasket , ring back up , cylinder , plug grease discharge , seal ring assy , nut , spacer , guard inner lh , pin master , seal dust master , pad rubber , pin assy , grommet , net , cover (lm) , cover(lm) , cover (lm) , cover assy , board floor , board floor , board floor , board floor , board floor , seat assy , hydraulic pump assy , strainer , seal oil , cap , o ring , element filter , o ring , o ring , seal bearing , seal kit , rod , bushing spherical , snap ring , o ring , o ring , bushing , o ring , hose , hose , flange , tube , bolt , pin and chain (lm) , pin , pin , washer spring , angle blade , cable tachohourmeter , switch temperature , horn , battery relay , terminal negative , water temp gauge , charge lamp , hose assy , tacho hour meter , dash lamp , eng oil pr gauge , switch starting , lamp indicator , lamp indicator eop , switch light

Central Government/Public Sector

CTN :39816476

15 Apr, 2025 NA

Jaduguda - Jharkhand

Tender For supply of bearing part no.245261 suitable for dana-spicer make transmission assy model no t-12000 , disc outer part no.245238 suitable for dana-spicer make transmission assy model no t-12000 , disc inner part no.245239 suitable for dana-spicer make transmission assy model no t-12000 , charge pump assy part no.246495 or 4212354 suitable for dana-spicer make transmission assy model no t-12000 , sleeve part no.246501 suitable for dana-spicer make transmission assy model no t-12000 , ring part no.230416 suitable for dana-spicer make transmission assy model no t-12000 , snap ring part no.245255 suitable for dana-spicer make transmission assy model no t-12000 , piston part no.4203230 suitable for dana-spicer make transmission assy model no t- 12000 , seal part no.244841 suitable for dana-spicer make transmission assy model no t-12000 , seal part no.244128 suitable for dana-spicer make transmission assy model no t-12000 , kit drive plate part no.802427 suitable for dana-spicer make transmission assy model no t-12000 , flange part no.4204895 suitable for dana- spicer make transmission assy model no t-12000 , bearing part no.225825 suitable for dana-spicer make transmission assy model no t-12000 , flange part no.246610 suitable for dana-spicer make transmission assy model no t-12000 , ring part no.246605 suitable for dana-spicer make transmission assy model no t-12000 , gasket part no.4201488 suitable for dana-spicer make transmission assy model no t-12000 , solenoid part no.4210504 suitable for dana-spicer make transmission assy model no t-12000 , gasket part no.4201489 suitable for dana-spicer make transmission assy model no t- 12000

Windscreen Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector

Central Government/Public Sector