Latest zinc alloy ingot Tenders | Government zinc alloy ingot Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39835487

16 Apr, 2025 NA

Mumbai - Maharashtra

Tender For tender for supply of crfq 1000433814 plate anode zinc dia 150 thk 50 , crfq 1000433814 plate sacrificial anode , crfq 1000433814 plate anode zinc , crfq 1000433814 aluminum anode , crfq 1000433814 aluminum anode 200 100 50 mm , crfq 1000433814 aluminum anode

CTN :39847016

17 Apr, 2025 NA

Sagar - Madhya Pradesh

Tender For supply of l lysine 20mg zinc 25mg dimethionine 40mg calcium pantothenate 50mg niacinamide50mg tab , bisacodyl 5 mg tab , bisoprolol 2 point 5mg tab , bisoprolol 5mg tab , brimonidine 0 point2 percent w byv eye drops , brivaracetam 100mg tab , bromhexine 100 ml syp , bupropion 150 mg tab , cabergoline 0percent5 mg tab , calamine lotion 100 ml , calcium and vit d3 syp 200ml bott , calcium carbonate and calcitirol and methulcobalamin and vitamin k2 and zinc tab , calcium citrate malate and vitamin d3 tab , canagliflozin 100 mg tab , mouth paint clotrimazole , carbamazepine 200 mg cr tab , carbidopa 10 mg and levodopa 100 mg cr tab , carbidopa 18 percent 75 and levodopa 75 mg and entacapone 200 mg tab , carbidopa 25 and levodopa 250 mg tab syndopa 275 mg , carbidopa 25 mg and levodopa 100 mg cr tab , carbimazole 5mg tab , carvedilol 12 percent5 mg tab , carvedilol 6 percent25 mg tab , cefixime 200 mg tab , cefixime 200mg and clavulanate 125 mg tab , cervical collar size l , cervical collar size m , cervical collar xl , cetrizine 5mg and paracetamol 325mg andphenylephrine hcl 5mg , chest binder all size , chlordiazepoxide 10 mg tab , chlordiazepoxide 5 mgand clidinium bromide 2 percent5 mg , chlorhexidine mouth wash 2 percent bott of 100 ml , chlorhexidine mouthwash 2 percent bottle of 150 ml , chlorthalidone 12 percent 5 mg tab , chlorthalidone 6 percent25 mg tab , choline salicylate 8 percent andlidocaine 2dologel , cilnidipine 10 mg tab , cilnidipine 5 mg tab , cilostazol 100 mg tab , cinitapride 3mg pantoprazole 40mg tab , cinnarizine 25mg tab , ciprofloxacin 500mg tab , clarithromycin 1 percent gel 15gm , clavicle support medium size , clindamycin 1 percentgel 10 gm , clindamycin 300 mg cap , clobazam 10mg tab , clobazam 5 mg tab , clobetasol miconozole gentamycin oint , clofazimine 100 mg cap , clonazepam 0 percent5 mg tab , clotrimazole 1 percent w by v ip and and lignocaine 2 percent w byv ip ear drop bott of 10ml , clotrimazole 100mg vaginal tablets , clotrimazole cream 1 percent tube of 15 gm , coenzyme q10 100 mg tab , colchicine 0 percent 5 mg tab , collagen peptide and hyaluronate tab , collagen peptide 40mg and sod hyluru 30mgand chondrotin tab , coloplast lubricating deodrant , coloplast paste 2650 , coloplast plate , colostomy bag 60 mm , colostomy bag with flange and clamp size 50and 57 mm with deodorant charcoal chamber , colostomy bag with flange and clamp size 60 and 67 mm with deodorant charcoal chamber , colostomy bag with flenge 50mm , colostomy bag with flenge 60mm , colostomy belt , corn cap , cotton 50 gm pkt , cotton absorbent 500 gm , cotton non absorbent 500 gm , cyclosporin 50 mg tab , cyproheptadine 4 mg tab , cyproterone 2mg ethinyl estradiol 0point0 35mg ginnete 35tab , dabigatran 110 mg tab , dapagliflozin 5 and linagliptin 10 mg tab , denosumab 120 mg by ml inj , dental gel , desensitising paste stannous fluoride potassium nitrate sod monofluorophosphate tube of 50gm , desvenlafaxine 100 mg tab , diclofenac 50 mg and paracetamol 325 mg tab , dicyclomine 10mg bid details/ 2 / 141 and mefenamic acid 250mg tab , digoxin 0 point 25 mg tab , diltiazem 60 mg tab , divalproex sodium cr 500 mg tab , domperidone 10 mg tab , donepezil 10 mg tab , donepezil 5 mg tab , dorzolamide 2 per w by v and timolol 0 point 5 percentw by v eye drop , dosulepin 25 mg dothiepin tab , dosulepindothiepin prothiadren 50 mg tab , doxepin 75 mg cap , duloxetine 20mg cap , duloxetine 30 mg tab , dutasteride 0.5 mg tab , dvt stocking medium , dvt stocking small , dvt stocking xl , dydrogesterone 10 mg duphaston tab , ear drop chloramphenicol 5percent w by v clotrimazole 1percent wby v betamethasone 0 point 25percent w by v lignocaine hcl 2percent w by v in bottle of 5 ml , ecg electrodes , ecg gel , ecg roll , eye drop 0point 2 per olopatadine hydrochloride with povidone iodine and drop tainer systme , ed carboxy methyl cellulose 0 point5 percent bott of 5ml , ed ciprofloxacin and dexamethasone , ed ciprofloxacin 0point 3 percen

CTN :39814681

15 Apr, 2025 NA

Medak-T - Telangana

Tender For supply of bolt 3m6.8gx16.46. 019 gost: 7798-70 , screw m6x8.66. 019, gost: 1476-75. equivalent: grub screw a- m6x8 to is: 2388-6.6 pitch 1mm a , screw m8x20.66. 019 gost: 1481-75 , nut m14x1.5. 6.019 gost: 2526-70 zinc plated 9 microns thick chromatized , nut m8.6. 019 gost 2526-70 , washer 8t65g06 gost 6402-70 , split pin/cotter pin 4x25.019 gost: 397-79. eqvt. material: split pin 4x25, is: 549, zinc plate , boss m10x18x70 ost 3-1496-72

CTN :39816466

15 Apr, 2025 NA

Ernakulam - Kerala

Tender For tender for supply of element for thermostat , o ring , s w pump k g e c 12 6 stork self prime sea water , turbocharger , impeller , gasket , gasket , mechanical seal , shaft , oil seal , key for impeller , 1 2 bsp zinc anod , washer set , liner plateu honed finish , fuel pump shaft , sleeve cylpointhead for oil , sleeve for cylinder head brass , tension roller assy , cam gear assy , gasket 3 thermostat casng , gasket , gasket for he 8 shell , hose piece , hose rubber , element marie , fresh water pump spares , push rod sleeve , screw hex , screw hex , hexagon screw , hexbolt m8x1point25x85 8point8cl , hexbolt m8x1point25x95 8point8cl , hex boltm10x60 931 8point8 , hexbolt m12x1point75x60 8 8point8cl , hexegon screw m14x2x60 8point8 cl , hex bolt m8x130 , screw hexagon , screw hexagon , hex bolt m16 x 150 10point9 d931 , screw hexagon , screw hexagon , screw hexagon , hex srew m12x40 cl18point8 , hexbolt m16x1point5x65 960 8g , screw hexagon , bolt m16x1point5x75 cl 10point9 , stud bolt , stud m8x110 5point8 cl , stud m8x1point25x25mm 8point8 cl , stud bolt m10x25 10point9 cl , stud bolt , stud bolt , nut hexagon , nut hexagon , hexagon nut , spring ring , spring washer , washer spring item srlpoint 10 & 31 , dowel pin , sleeve clamping , grooved dowel pin , spring plate , clamping element , spring pressure , valve spring , valve spring , ring locking , bearing ball grooued 6011 , ball bearing , bearing ball grooued 6206 , ball bearing , cap roto , clip hose , hose calmp strip , clamp , valve exhaust , valve starting air , washer copper , washer copper , washer copper , washer copper , washer copper , washer , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , o ring , liner o ring , filter disposable , starter spider complete , mounting vibration damper washer , o ring , shaped gasket

CTN :39816498

16 Apr, 2025 NA

Mumbai - Maharashtra

Tender For tender for supply of oring 3410 x 360 20a8 gn , oring 325x355 , oring 500 x 180 20a8 an , oring 1600 x 265 20a8 an , oring 4000 x 265 20a8 an , oring 4250 x 355 20a8 an , cotter pin 25x25 , pin v 6371 copper , thick spring pin 7x20 , screw h m8x16x16 ss a4 b197 , spring , ring dia 16 , lock plate , lever release spring , tongue spring , pin cylindrical 4 l 28 , oring , screw m8x16x16 , lock washer dn14 , natural rubber sheet 45didc th2 , lamp 28v 48w ba15d 165x33mm minilamp , sea water hose nd26 bar without unions l150 m , square sleeve 400 x 315 , flexible sleeve for square duct 192 x 512 , elastic element , packing gland c25x33x4 , steel screw h m12x50x50 88 , hose 10x25 rubber h650 a , oring 570x19020a8gn , oring 1210x27020a8gn , lock tab washer , silicone sheet 1000x1000x4 , oring 2512x178 , oring 283x178 , zylinder pin din6325 , bernard actuator oa8 115v 60hz 3ph marine ral7038 , fl di qfa 384x192 corrugated metallic gasket , fhari hose peh200 bar nd15 staubli unions l2 m , fitted screw , gasket stop , adjusting shim , tab of earthing typifies rm1 , oring , oring , rubber bellow ar1 dn 350 , rubber bellow a1 dn 450 , screw h m6x16x16 z5cnd170401 , nut hm 10 cl8 , raising line , retracting line , air hp hose peh500 bar nd10 m27x2 cual ruch union l2870m , flexible air peh500 dn15 raccord ruch cual lht05m , window frame seal , lamp housing seal , port side part cylindrical array acoustic window , pin v1515 stainless steel 2972 015 , lock plate diam5 stainless steel 1780105 , lockplate 12 z3cn1810 1780112 , metallic clamp d816 made of stainless steel , extremlty seals od the holding cross , oring 1830x360 20a8gn , oring 4370x180 20a8 8566423 , neoprene butterfly gasket , oring 1500x180 20a8 8547623 , oring 6700x180 20a8 8573423 , wall mounted temperature and humidity sensor type dpwc111000 , filter seat , filter , o2 sensor , h2 sensor , srew hm 12x35x35 cl88 coated , pressure transmitter 015 bar absolute g1/4 female , pressure switch sensing elementfor fpm34dkxnsn , pressure switch sensing elementfor fpm34dqxnsn , temperature switch sensing elementfor fcm34dgnsn , thermal flow sensor ta10 , double washer of safety , overmouled electrode unit ref 400 , turcon stepseal seal k 90105163 oring 946x533 , guide ring 909597 c380 , nut h m 12 z6cnd170401 , lock tab washer nd16 , spare seals kit for wafer valve dn32 , spare seals kit for wafer valve dn40 , spare seals kit for wafer valve dn50 , oring 18x18 20a8 , oring 355x265 20a8 , oring 45x355 20a8 , oring 85x355 20a8 , oring 105x27x15990sh , shell oring for closing plate dia 330x5 , lock washer , cover oring , flange oring , oring 800x265 64c8 , plain washer zinc plated steel dn20 , folded removable filter , oring 18x2x22nbr90sh , oring 6x2x10nbr90sh , vandalproof showerhead atomized water function , locking screw , bolt ha m36225/32 cl88 + specificnut cl8 , cartridge 200u , oring for diaphragm , lock tab washer nd8 galvanized steel , lock tab washer nd14 zinccoated steel , repair set shaft seal , lock washer , spring , double lock tab washer rep q , piston rod , grounding braids assembly , oring , cotter copper pin 2x18 , washer nl m14 stainless steel , bubble inclinometer

CTN :39430563

27 Mar, 2025 5.87 Crore

Uttara Kannada - Karnataka

Tender For corrigendum : procurement of of distilling plant spares - tender for supply of filter/regulator incl pr gauge , set of manometers for pump , thermometer , temp transmitter pt100 , butterfly valve , t-piece with flange & skt hwlm 35-60 , t-piece with flanges hwlm 35-60 , fastening bow hwl 35-60 , regulating valve dn65 pn25 , steam trap dn40 incl cert , butterfly valve type 2232 , gasket dn100 162115 1 5mm , gasket 127 77 x 15 mm , screw , screw , screw m1660 din933 , screw , screw , washer , washer m16 din 125 a , washer , set of manometers for pump , nut , nut , nut m20 din 934 , gasket 9249 x 15 , air valve 14 bsp bronze , washer , shaft complete , impeller 180 , o-ring , mechanical seal 35 , seal ring , wear ring - upper , washer , spring washer , screw , screw , screw , screw m12x30 , plug , key , washer , plug 1-4 bsp , motor w22 15-18kw 50/60hz gl 3 phase , ball bearing , ball bearing , cover incl item 7 9 25 , base , impeller 192 , o-ring 215 49 x 3 53 , wear ring incl screws , wear ring incl screws , spring washer , washer , screw , screw , plug 38 bsp , plug 1-4 bsp , key 8 x 7 x 30 , cip unit for aqua fwg 220-230v , aqua ii rubber sleeve sw out , pvc hose with steel coil , hexagon nipple , sticker safety signs , plate p36-ti-0.6-nbrb-es , plate p36-ti-0.6-nbrb-ev 55 , plate p36-ti-0.6-nbrb-ed , plate p36-ti-0.6-nbrb-ee ke , plate p36-ti-0.6-nbrb-ks , plate p36-ti-0.6-nbrb-kv , plate p36-ti-0.6-nbrb-kd , plate p36-ti-0.6-nbrb-ev 10 , clamping bolt l1-450 mm , motor w22 71 -2 220-480v , name plate fwg , feedwater injection , set of manometers for pump , coil solenoid valve ev220 230v , zinc anode , diaphragm , pressure gauge 0-3bar 1-44 bsp , pressure gauge 0-10bar 1-4 bsp , nozzle 3 dn100 id 49 9 , shaft incl keyscrews washer , impeller 156 , water meter efw 4 incl unions , flowmeter with reg valve , orifice d 13 9 , pressure gauge 63 -1-5bar , compound gauge -1-2bar , pressure gauge 63 -1-5 bar , electrode for ds-20 , thermometer boiling temp , non-return valve w sight glass , safety valve 1bsp , ball valve 1-2bsp , spring loaded valvemvf-40-2.5 , spring loaded valve mv-25-1.2 , non-return valve 1 bsp , ball valve 1-2bsp , ball valve 1 bsp , non-return valve 3-8 bsp , compound gauge 2bar 3-8 bsp , butterfly valve , ball valve 3-8 bsp , seat valve , impeller 149 , gasket pvvf 2040 , shaft complete , screw , screw m5x 8 din 916 , seal ring60x 50x12mm , plug 1-8 , key 4 x 4 x 15 key 4x4x15 , screw m5x16 din7991 , mechanical seal 16 nitrile , washer iso 6831386 , solenoid valve 1230v 50-60 cs , coil for solenoid valve , spare part kit diaphragm nc1-2 , motor w22 80 50-60hz gl 3-phase , ball bearing , ball bearing , motor w22 16050-60hz gl 3-phase , main switch ot80f3 , door handle ohbs2aj , shaft oxs6x160 , thermal relay 3ru2126-4pb0 , thermal relay 3ru2126-4eb0 , thermal relay 3ru2116-1db0 , mcb s202m-c10 10a - 2p , mcb s202m-c1 1a - 2p , green led lamp cl2-523g , contactor 3rt2028-1al20 , auxiliary contact 3rh2911-1ha21 , push button cp110r-01 red , push button cp110g-10 green , contactor 3rt2027-1al20 230vac , contactor 3rt2015-1ap01 230vac , led lamp cl2-523c white , control valve gland packing , control valve gasket , control valve baffle plate , control valve actuator , dsh body seal kit , dsh actuator , pump o ring kit , pump shaft seal kit , pump wear parts kit , temperature transmitter , temperature gauge , pressure gauge- inlet , pressure gauge- outlet , pid controller for prs , pressure transmitter , pid controller for dsh

CTN :39774927

10 Apr, 2025 NA

Sonitpur - Assam

Tender For supply of cement opc 43 grade packed in hdpe bag each 50 kg wt conforming to is 8112 1989 make birla gold or ambuja or ultratech or acc or jkj dalmia , stone boulder 9inch to 12inch , coarse aggregate 40 to 63mm , coarse sand free from vegetation , coarse aggregate 20mm graded . , coarse aggregate 40mm graded , water proofing compund conforming to is 2645 2003 make pidilite or dr fixit or fevicol , pbs roll 20m long width of 0 point 9mtr isi marked with min weight of 34 kgs per roll , cement based paint snowcem make berger or asian or nerolac , synthetic paint enamelled og conforming to is 5 ur 2004 make asian or berqer or nerolac , synthetic paint enamelled brown confirming to is 5 2004 make berger or asian or nerolac , anti corrosive red oxide zinc chromate primer conforming to is 5 2004 make asian or berger or nerolac , loop holes 1000 x 300 mm make tata or sail or jsw , ventilator steel 300 x 450 mm will be fabricated using isa 35 x 35 x 5mm for outer frame and isa 30 x 30x 3mm for shutter frame with blace sheet as per ts , ms binding wire , ismb hot rolled ms 125 4000 mm long make tata or sail or jsw , isms hot rolled ms 125 1200 mm long make tata or sail or jsw , srt 1840 x 613x 180 mm 2 mm thick ms sheet hot rolled steel with nuts bolt incl one coat of red oxide make tata or sail or jsw , prefeb mild steel door of size 900x 1700mm outer frame made out of isa 40x 40x6mm and door shutter frame of isa 35x35x5mm and all stiffner as per ts , hdpe sand bags khaki colour of size 30 inchx15inch inside laminated interlocking stiched weight of the each bag should not be less then 42 45 gms per bag , mild steel bar of size 6 to 8 mm dia conforming to is 432 part ll 1982 make tata or sail or jsw , prefeb folding double sleeping bunks madeof ms columns 65x 65x6mm and ms plate form made of isa 40x40x6mm hold fast 65x65x6mm 230mm long 12mm as per ts , polythene sheet colour less and weight of sheet shall be not less than 70gm or sqm , wooden planks for shuttering llnd class wood of size 3 point 0 x 0 point 30 x 0 point 026m , wooden scantling various sizes , nails various size , earthing plate 600x600x6mm gi steel suitable for gi strip fittings drilled with two nos holes for 6 mm dia near one side , air termination single pointed aluminium rod 12mm dia and 300mm long , gi pipe 20 mm dia light grade make jindal or tata or kalinga , gi pipe 40 mm dia light grade make jindal or tata or kalinga , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt make presto or polycab or finolex , testing point terminal block made of gun metal phosphorus bronze size 75x75x25mm drilled and screwed including 3 nos 8mm dia 25mm long hexagonal head screw , aluminium strips 25x3mm , nut and bolts 6 mm dia 30mm long with check nut and washer , charcoal , salt normal , ci earth pit cover of size 300x300x6mm with angle iron of size 20x20x3mm thick with ms frame , funnel fitted with 20 mm diameter gi pipe 1 point 5 m long pipe make jindal or tata or kalinga , galvanised iron strip 32x6mm

CTN :39809372

14 Apr, 2025 NA

Sonitpur - Assam

Tender For supply of construction material of amn bkr 50 mt with ohp - cement and all other specification as per rfp , coarse sand free from vegetation and all other specification as per rfp , coarse aggregate and all other specification as per rfp , hardcore and all other specification as per rfp , aac blocks and all other specification as per rfp , mild steel bars and all other specification as per rfp , ms binding wire and all other specification as per rfp , wooden plank and all other specification as per rfp , acrylic emulsion paint and all other specification as per rfp , wooden scantling and all other specification as per rfp , oil bound distemper and all other specification as per rfp , synthetic enamel paint and all other specification as per rfp , steel props and all other specification as per rfp , water proofing compound and all other specification as per rfp , painting brush and all other specification as per rfp , nails and all other specification as per rfp , ms rhs and all other specification as per rfp , ms plate and all other specification as per rfp , ms nuts and bolts and all other specification as per rfp , ppgi sheet and all other specification as per rfp , ppgi ridge sheet and all other specification as per rfp , self taping steel screw and all other specification as per rfp , hdpe sand bags and all other specification as per rfp , door and all other specification as per rfp , ventilator with grill and all other specification as per rfp , gate and all other specification as per rfp , anti corrosive red oxide zinc and all other specification as per rfp , while lime and all other specification as per rfp , waterproofing compound and all other specification as per rfp , cement based paint and all other specification as per rfp , brick and all other specification as per rfp , three phase 1.2 hp monoblock pump and all other specification as per rfp , air termination single pointed aluminium rod and all other specification as per rfp , testing point terminal block and all other specification as per rfp , aluminium strips and all other specification as per rfp , galvanized iron strip and all other specification as per rfp , earthing plate and all other specification as per rfp , charcoal and all other specification as per rfp , salt normal and all other specification as per rfp , ci earth pit cover and all other specification as per rfp , nut bolt and all other specification as per rfp , gi pipe and all other specification as per rfp , insulating pvc block and all other specification as per rfp , non woven geotextile and all other specification as per rfp , 2 mm thick pvc-p water proofing membrane and all other specification as per rfp , non woven geotextile 500gsm and all other specification as per rfp , water proofing membrane and all other specification as per rfp , high quality adhesive and all other specification as per rfp , coarse aggregate and all other specification as per rfp , stone boulder and all other specification as per rfp , pvc pipe and all other specification as per rfp

CTN :39809401

14 Apr, 2025 NA

Sonitpur - Assam

Tender For supply of construction material of amn bkr inf 30 mt - cement and all other specification as per rfp , coarse sand free from vegetation and all other specification as per rfp , coarse aggregate and all other specification as per rfp , hardcore and all other specification as per rfp , aac blocks and all other specification as per rfp , mild steel bars and all other specification as per rfp , ms binding wire and all other specification as per rfp , wooden plank and all other specification as per rfp , acrylic emulsion paint and all other specification as per rfp , wooden scantling and all other specification as per rfp , oil bound distemper and all other specification as per rfp , wooden log and all other specification as per rfp , synthetic enamel paint and all other specification as per rfp , painting brush and all other specification as per rfp , nails and all other specification as per rfp , ms rhs and all other specification as per rfp , ms plate and all other specification as per rfp , ms nuts and bolts and all other specification as per rfp , pre painted galvatume aluminium and all other specification as per rfp , ppgi ridge sheet and all other specification as per rfp , self taping steel screw and all other specification as per rfp , hdpe sand bags and all other specification as per rfp , door size and all other specification as per rfp , door and all other specification as per rfp , ventilator with grill and all other specification as per rfp , gate size and all other specification as per rfp , anti corrosive red oxide zinc chromate primer and all other specification as per rfp , while lime and all other specification as per rfp , waterproofing compound and all other specification as per rfp , cement based paint and all other specification as per rfp , brick and all other specification as per rfp , three phase 1.2 hp monoblock pump and all other specification as per rfp , air termination single pointed aluminium rod and all other specification as per rfp , testing point terminal block and all other specification as per rfp , aluminium strips and all other specification as per rfp , galvanized iron strip and all other specification as per rfp , earthing plate and all other specification as per rfp , charcoal and all other specification as per rfp , salt and all other specification as per rfp , ci earth pit cover and all other specification as per rfp , nut bolt and all other specification as per rfp , gi pipe and all other specification as per rfp , insulating pvc block and all other specification as per rfp , non woven geotextile and all other specification as per rfp , pvc p water proofing membrane and all other specification as per rfp , water proofing membrane and all other specification as per rfp , high quality adhesive for termination and all other specification as per rfp , coarse sand free from vegetation and all other specification as per rfp , coarse aggregate and all other specification as per rfp , stone boulder and all other specification as per rfp , pvc pipe and all other specification as per rfp

Zinc Alloy Ingot Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector