Latest zirconium oxychloride Tenders | Government zirconium oxychloride Tenders

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

CTN :39846918

17 Apr, 2025 14.57 Lacs

Belgaum - Karnataka

Tender For supply of drug and medicine - adapalene 0 point 1 percent tube of 15 gm , tacrolimus oint 0 point 03 percent 20 gm tube , benzoyl peroxide 2 point 5 percent tube of 20 gm tube , calamine lotion 50 ml tube , betamethasone dipropionate 0 point 05mg gentamycin sulphate 1mg tube of 5gm , zinc oxide titanium dioxide bott 50 sunscreen lotion bottle of 60 ml , clindamycin phosphate 1 percent topical gel tube of 10 gm , clobetasol propionate cream 0 point 05 percent in tube of 10 gm , desonide 0 point 05 percent bott of 30 ml , fluticasone 0 point 05 percent w per w cream 10gm tube , liquor formaldehyde 40 percent w v , framycetin sulphate cream bp 1 percent cream 20 gms , ketoconazole lotion 2 percent bott of 75ml , isotretinoin 20 mg cap , metronidazole 1 percent tube of 30gm , permethrin 5 percent tube of 30 gm , lotion terbinafine 1 percent 20 ml , terbinafine 1 percent cream tube of 10 gm , tretinoin 0 point 05 percent tube of 20 gm , hydroxyzine hcl 25mgtab , fusidic acid cream 2 percent w per w 10g tube , paradhichlorobenzene 2 percent benzocaine percent chorbutol 5 percent turpentine oil 15 percent ear drop clear wax , sodium hypochlorite 5 percent , 10 percent povidone iodine solution 1 percent iodine 500 ml bott , chloroxylenol hydroxide 13 point 6g chloroxylenol solution 50 point 5g oleic acid 7 point 5ml castor oil 63 point 0g terpineal 100ml ethanol 96 percent 200ml , chlorhexidine chlorhexidine gluconate7point 5 percent cetrimide bp 15 percent 500 ml bott , povidone iodine solution 5 percent bottle of 100 ml , acetazolamide 0 pouint 25g tab , tab dutasteride 0 point5 mg , cilnidipine 5 mg tab , frusemide 40 mg tab , frusemide 20 mg 2 ml inj , eplerenone 25 mg tab , spironolactone 50 mg tab , rifaximin 550mg cap ,frusemide 40 mg amiloride hydrochloride 5 mg tab , pancreatic enzyme supplement lipase content of 25000 units cap , antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg , tab levosulpiride 25 mg , tab entacavir 0 point 5 mg , antacid chewable aioh 3 300mg mg silicate 25 mg simethicone 25 mg , trypsin and chymotrypsin 6 ratio 1 100000 au enteric coated tab , ranitidine hcl 50 mg 2 ml inj , metoclopramide 10 mg tab , metoclopramide hcl 5mg ml 2ml inj , dicyclomine 20 mg paracetamol 500 mg tab , dicyclomine hcl 20mg inj , drotaverine hcl 20 mg per ml inj , hyoscine bromide inj 20 mg per ml 1ml inj , mebeverine hcl 135mg tab , isapgol ispaghula husk 3 point 5 gm , bisacodyl 5 mg tab , parraffin liq in bottle of 100 ml , pancreatic enzyme cap lipase content of 10000 to 20000 units , loperamide 2mg tab , pantoprazole 40 mg domperidone sr 30 mg cap , pantoprazole 40 mg levosulpride 75 mg cap , rifaximine 400 mg tab , ethinyl estradiol 0 point 035mg cyproterone acetate 2mg pack of 21 tablets , oestrogen cream concentration 0 point 06 percent to 0 point 1 percent tube of 15 to 50 gms , clotrimazole vaginal pessary 100mg , levonorgestrel 0 point 25 mg ethinylestradiol 0 point 03mg pack of 21 tab , nor ethisterone 5mg tab , gliclazide mr 30 mg tab , glipizide 5mg tab , glibenclamide 5mg tab , sitagliptin 50 mg metformin 1000mg tab , linagliptin 2 point 5 mg metformin 500 mg , pioglitazone hydrochloride 15 mg tab , carbimazole 5 mg tab , alendronate sodium 70mg tab , pyridostigmine 60 mg tab , calcium acetate 500 mg tab , protein supplement for predialysis renal failure , sevelamer 400 mg tab , betaxolol eye drops 0 point 25 percent 0 point 5 percent bott of 5 ml , chloramphenicol 0 point 5 percent dexamethasone sodium 0 point 1 percent bott of 5 ml , ciprofloxacin hcl 0 point 3 percent dexamethasone 0 point 1 percent bott of 5ml , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , gentamicin sulphate 0 point 3 percent gentamicin base with hydrocortisone acetate ip 1 percent eye ear drops bott of 5 ml , ketorolac tromethamine 0 point 4 percent eye drops , brimonidine tartrate 0 point 2 percent eye drops , methyl cellullose 2 percent solution bottle of 5 ml , ofloxacin 0 point 3 percent bott of 5 ml , luli

Central Government/Public Sector

CTN :39848740

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.24) iv solution ringer lactate containing sodium hydroxide 0.32gm, sodium chloride 0.50gm, potassium chloride 40mg, calcium chloride mg, 500ml bottle

Central Government/Public Sector

CTN :39857974

18 Apr, 2025 1.39 Lacs

Kanpur - Uttar Pradesh

Tender For supply of agno3 0.1 mol/l, silver nitrate solution, 0.1 mol/l (n/10) , buffer solution ph-7.0 , buffer solution ph- 4.0 , buffer solution ph-9 , ethenol , ammonia solution 25% , sodium thiosulphate std sol (n/10) , sulphuric acid std, solution, 1 n , edta 0.1 mol/l , sodium hydroxide std sol (n/10) , sodium hydroxide std sol (1 n) , silver nitrate , potasium iodide , disodium oxalate

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Corporations And Associations And Others

CTN :38767761

04 Apr, 2025 NA

Hisar - Haryana

Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39320533

28 Mar, 2025 20.23 Lacs

Ranchi - Jharkhand

Tender For bid to ras supply of ether solvent , ketamine hcl 50 mg oblique ml 2 ml inj , thiopentone inj of 0point5 g without water for injection , bupivacaine hcl 5 mgobliqueml 20 ml inj , bupivacaine hcl 5 mgobliqueml heavy 4 ml inj , lignocaine hcl 2percent without adrenaline 30 ml inj suitable for ophthalmic use also , lignocaine hcl 2percen with adrenaline , lidocaine oblique lignocaine hcl 2percent with adrenaline , atropine sulphate 0point6 mg 1 ml inj , peracetic acid bott of 810 gm , diclofenac sodium suppository 100 mg , indicator soda lime , paracetamol with cysteine hcl monohydrate infusion 1000mgoblique100ml , common cold tab antihistiminics plus paracetamol 500 mg without pseudoephedrine , etoricoxib 120 mg tab , piroxicam 20 mg tab , fentanyl citrate 50mcgoblique ml 2 ml inj , fentanyl 50mcgoblique ml 10 ml inj , morphine 15 mg 1 ml inj , indomethacin 75 mg sr tab , indomethacin 25mg tab oblique cap , ketorolac 10 mg tab , tramadol hcl 50 mg cap oblique tab , betamethasone 4mg 1ml inj , adrenaline tartrate 1 isto 1000 coma 1 ml inj , levo des cetrizine 5mg tab , dexamethasone 0point5 mg tab , pheniramine maleate inj 22point75 mg per ml amp of 2 ml , methylprednisolone 16 mg tab , promethazine hcl 2point5 percent 25mgm oblique ml 2 ml inj , levetiracetam 100mg oblique ml vial of 5 ml inj , piracetam 400 mg tab , oxcarbazepine 150 mg tab , carbamazepine 200 mg tab , clonazepam 2 mg tab , lorazepam 2mg oblique ml 2 ml inj , diazepam 5 mg tab , lamotrigine 25 mg tab , lamotrigine 50 mg tab , sumatriptan 50 mg tab , topiramate 25 mg tab , rizatriptan 5 mg tab , baclofen 10 mg tab , acebrophylline 100 mg cap , budesunide 1 mg respules , carbimazole 20 mg tab , ethambutol 1200 mg tab , mycophenolate mofetil 250 mg tab , diethylcarbamazine 50mg tab , clofazimine 100mg cap , rifampicin 150mg cap , rifampicin 600 mg plus tab inh 300mg tab , ethambutol 200mg tab , isoniazid 300 mg tab , chloroquine phosphate 250mg tab , primaquine 7point 5mg base tab , silver sulphadiazine 1 percent ointment 20 gm tube , azathioprine 50mg tab , cyclosporine a micro emulsion 25 mg cap , hydroxyurea 500 mg cap , methotrexate 5 mg tab , inj goserelin 3point6 mg prefilled syringe zoladex 3point6 mg , letrozole 2point5 mg tab , levodopa 100 mg and carbidopa 25 mg tab , amantadine 100 mg cap , cabergoline 0point5 mg tab , rasagiline 1mg tab , trihexyphenidyl hcl 2 mg tab , tab levodopa 125 mg , tab levodopa cr 250 mg , tab topiramate 50mg , tab pregablin 75 mg , ferric hydroxide sucrose complex 20 mg in 5ml for injection , erythropoeitin human recombinant 2000 iu , tranexamic acid 500 mg oblique 5ml inj , phytomenadione vit k 1 mg oblique 0point5 ml inj , prasugrel 10 mg tab , fenofibrate 160 mg tab , carvedilol 3point125mg tab , diltiazem 60 mg tab , diltiazem controlled delivery 90mg tab , fenofibrate 200 mg tab , isosorbide dinitrate 10 mg tab , isosorbide mononitrate 20 mg tab , tab perindopril 8mg , esmolol 100 mg 10 ml inj , prasugrel hcl 5 mg tab , lignocaine hcl solution 2percent for iv use 50 ml inj , enalapril maleate 10 mg tab , enalapril maleate 2point5 mg tab , nebivoilol 5mg tab , labetalol hcl 100 mg tab , metoprolol 1 mg oblique ml 5 ml inj , nifedipine retard 20 mg cap oblique tab , propranolol tr 40 mg tab , ramipiril 2point5 mg tab , digoxin 0point25 mg tab

	Mar 2025
Su	Mo	Tu	We	Th	Fr	Sa
23	24	25	26	27	28	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	29
30	31	1	2	3	4	5

	Feb 2025
Su	Mo	Tu	We	Th	Fr	Sa
26	27	28	29	30	31	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	1
2	3	4	5	6	7	8

	Mar 2025
Su	Mo	Tu	We	Th	Fr	Sa
23	24	25	26	27	28	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	29
30	31	1	2	3	4	5

	Feb 2025
Su	Mo	Tu	We	Th	Fr	Sa
26	27	28	29	30	31	1
2	3	4	5	6	7	8
9	10	11	12	13	14	15
16	17	18	19	20	21	22
23	24	25	26	27	28	1
2	3	4	5	6	7	8

Zirconium Oxychloride Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Corporations And Associations And Others

State Government