Kangra Tenders

Get complete information related to latest Kangra Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Kangra Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Kangra Tenders .

Filter

Loading....

Get Tender in Email

State Government

CTN :39840701

07 Apr, 2025 14.00 Lacs

Kangra - Himachal Pradesh

Tender For providing and installation of 4 nos.) india mark- -ii, 32mm deep well handpumps in non tribal district under jal shakti division jaisinghpur in tehsil jaisinghpur distt. kangra

Central Government/Public Sector

CTN :39112747

29 Mar, 2025 35.04 Lacs

Kangra - Himachal Pradesh

Tender For bid to ras supply of all in one desktop

Central Government/Public Sector

CTN :39842041

16 Apr, 2025 35.00 Lacs

Kangra - Himachal Pradesh

Tender For comprehensive repairs to otm accn of 9 corps camp at yol cantt under age b/r-ii of ge (kh) yol

State Government

CTN :39770334

02 Apr, 2025 2.85 Lacs

Kangra - Himachal Pradesh

Tender For corrigendum : providing assisting facilities to help the watch ward of damaged pskcm

Central Government/Public Sector

CTN :39842036

16 Apr, 2025 25.00 Lacs

Kangra - Himachal Pradesh

Tender For periodical services to otm accn of corps hq, corps and 9 csr at yol cantt under age b/r-ii of ge (kh) yol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39791588

02 Apr, 2025 2.36 Lacs

Kangra - Himachal Pradesh

Tender For corrigendum : for cleaning sweeping mopping in rest camp at holi cutting uprooting the grass bushes surrounding rest camp colony at holi hep

State Government

CTN :39840700

07 Apr, 2025 6.44 Lacs

Kangra - Himachal Pradesh

Tender For providing lwss andrana bandhan in tehsil jaisinghpur distt. kangra hp

State Government

CTN :39840705

05 Apr, 2025 10.43 Lacs

Kangra - Himachal Pradesh

Tender For supply and erection of submersible pumping machinery and centrifugal pumping machinery with its allied accessories and laying jointing and testing of rising main 65mm dia gi medium class duly ms flanged every 100 mtrs ic intermediate butt weldi

State Government

CTN :39840699

05 Apr, 2025 6.57 Lacs

Kangra - Himachal Pradesh

Tender For providing and installation of submerssible pumping machinery 7.50 hp, centrifugal pumping machinery 20 hp and laying, jointing testing of rising main 150mm dia g.i. medium class 550 mtr stage ist and 2nd

Loading, Please wait...

Kangra Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors