Web Analytics Made Easy - StatCounter

Sikkim Tenders

Get complete information related to latest Sikkim Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sikkim Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sikkim Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :38319140 Due date: 14 Dec, 202414 Dec, 2024 NA
Tender For supply of hi tea and lunch

State Government

CTN :38175641 Due date: 02 Dec, 202402 Dec, 2024 2.00 Lacs
Tender For supply of primer - acaggtctccatacggcatc , frwd tccttcaaatctcccatcaa rev aacggtggaaactattgaaa gg , frwd ccaggccacatagaactcaag rev tgcgtcgaaaatagttgcat , frwd atctcattcaacgcacacca rev gacatgccacttagatccacca , frwd accgccctagccataaagac rev tgaagtcgtctcatggttcg , frwd gaggacgacaacaacaacga rev aattgagaaagagtgtgtgtg , frwd ggtccagttcaatcaaccga rev gtttccaagaccagcactccaaa c , frwd gacaagctgtgaagttta t rev gtttcgagcttatggctacactg gacct , frwd atgcagctcccataaacc ctaaaa rev gtttgttcgtacttcatcgtgttggc , frwd tgataagaagggcaagct cagtcc rev gtttgttcgtacttcatcgtgttggc , frwd atacattctacccaactatccttcca rev gtttccctaaaaggaatatgtgctctgg , frwd atacattctacccaactatccttcca rev tctctcctactgaaacaaccaa , frwd agtgctctgaactcctttccttca rev ttcttccagagcattgcccat , frwd cctaaagaagataggaagaaatgcc rev atttgcatgggacctgatct , frwd aggcctgtttcaatcacctg rev cacccttcaccaccaacaat , frwd aataaagttatgccacagggc revgcaatgaaggcctacagatgac , frwd cgatgagaggaccggtaaga rev tacttctccccattccatgc , frwd tgaggtgcaaatggggtagtg rev tgcttttcacctctccgctatctc , frwd ttgcagaagcaacccttgac rev gtttgcacaatcatcaaggctcctcttt , frwd ttgaaccaagaatctattcg rev gaacttgaatgcctaccaaa , frwd tgcggatactatcggaaa ta rev caactcatttcagtccgatt , frwd tcactcggtgagtcaata gat rev tttgccgatgttatcatgt , frwd aga agg tca cgg cga ga rev tga gtc ctg agt aac tgg 5 -cacacacacacacacarc-3 issr-02 marigold marker type, 5 -gagagagagagagagayt-3 issr-03 marigold marker type, 5 -gagagagagagagagayc-3 issr-04 marigold marker type, 5 -agagagagagagagagyt-3 issr- 06 marigold marker type, 5 -agagagagagagagagyc-3 issr-07 marigold marker type, 5 -agagagagagagagagc-3 5 -gagagagagagagagat-3 5 -gagagagagagagagac-3 5 -ctctctctctctctc trc-3 5 -ctctctctctct-3 5 - vhvgtgtgtgtgtgtgt-3 5 -agagagagagagagagvc-3 , gttggtggct cggtttggaa caagggaggt ctaggggctg ttggcacggg tgccgagctg gtccacacgg gaccgcttgt crop-brinjal, forward sequence reverse sequence ccc att tca cac aca agc aa ctc tat tgc cac ccc aag tg ctcagaaactggataaactcgaag ggagaaagcagccagccattttt ggaaatattggttacaatccagtg gaatacaacaaatcactaccggtc gttttccttgcaaatcattttggc gtatatgttgagttcacaattccc cttcttgataggacgacgtgatat caatcaacggatcacccatttttc gttacacgaacaagcttaaatttcta gatttatccc gtaatcaattcgaaggacctgtc cggtgatgagcaggattgataaaa agtcttggcctttgacgtgaaagtgacaca agaag gttacacgaacaagcttaaatttcta gatttatccc bid details/ 2 / 44

CTN :38163335 Due date: 29 Nov, 202429 Nov, 2024 NA
Tender For supply of re 04 lab reagents - erba elite 580 diluent pkt of 20 ltr for fully automatic 5 part hematology analyser , erba elite 580 lyse 1 bott of 500 ml for fully automatic 5 part hematology analyser , erba elite 580 lyse 2 bott of 500 ml for fully automatic 5 part hematology analyser , erba elite 580 lyse 3 bott of 500 ml for fully automatic 5 part hematology analyser , erba elite 580 h clean bott of 50 ml for fully automatic 5 part hematology analyser , erba calibrator bott of 3 ml for fully automatic 5 part hematology analyser , erba controls h l n bott of 3 ml for fully automatic 5 part hematology analyser , erba bilirubin direct pkt of 337.8 ml product code 120623 for fully automatic biochemistry analyser , erba bilirubin total pkt of 337.8 ml product code 120621 for fully automatic biochemistry analyser , erba cholestrol pkt of 440 ml product code 121021 for fully automatic biochemistry analyser , erba creatinine enzymatic pkt of 200 ml product code 121200 for fully automatic biochemistry analyser , erba autowash system pack pkt of 1000 ml product code 120958 for fully automatic biochemistry analyser , erba norm pkt of 20 ml product code 120218 for fully automatic biochemistry analyser , erba path pkt of 20 ml product code 120220 for fully automatic biochemistry analyser , erba glucose god-pod pkt of 440 ml product code 120266 for fully automatic biochemistry analyser , erba sgot el pkt of 339 ml product code 120616 for fully automatic biochemistry analyser , erba sgpt el pkt of 339 ml product code 120617 for fully automatic biochemistry analyser , erba urea pkt of 275 ml product code 121025 for fully automatic biochemistry analyser , erba xl multical pkt of 12 ml product code 120611 for fully automatic biochemistry analyser , erba sample cup pkt of 500 cups product code 115777 for fully automatic biochemistry analyser , acid alkali bott of 50 ml for fully automatic biochemistry analyser , pcr tube with dome cap 0.5 ml for fully automatic biochemistry analyser , erba uric acid pkt of 275 ml product code 121023 for fully automatic biochemistry analyser , eppendrof micro centrifuge tube of 1.5 ml

CTN :38163167 Due date: 30 Nov, 202430 Nov, 2024 NA
Tender For supply of return roller 89x630mm wmfbf 406 1 2 06 , padelstal ucp 209 wmfbc 406 1 1 15 , gathering gear box wmfbf 406 1 2 12 , v belt c 96 c2494lp , take up bearing ucp 209 wmfbc 406 1 1 16 , gathering roller wmfbf 406 1 2 04 , return roller wmfbc 406 1 1 11 , dc motor 2 hp 1500 rpm wmfbc 406 1 1 06 , tail roller wmfbc 406 1 1 08 , belt conveyor 24500x500 wmloc 406 1 5 06 , carrying roller 89x180 wmloc 406 1 5 07 , return roller 89x530 wmloc 406 1 5 08 , padelstal bearing p210 wmsc 406 1 3 05 , ac drive model no. vsb48 004 20cnb nk , mcb ch5n nk , dc motor 2 hp wmfbf 406 1 2 18 , vibration motor 1hp 950 rpm ac wmfbc 406 1 1 05 , v belt b 52 wmfbc 406 1 1 19 , gathering roller 89x200 mm wmfbf 406 1 2 04 , fuel pipe pump to fuel filter nk , fuel pipe motor to drive drum burner nk , v belt b 54 wmsc 406 1 3 09 , v belt b 58 wmtdd 406 1 9 16 , v belt c 76 wmapcu 406 1 18 06 , nylon couple hydex wmps 406 1 17 15 , couple wmpp 406 1 14 12 , hyd hose for hooper jack nk , oil filter ek6231 605411880008 , air cleaner filter pre 35 cm length 19 cm width p21109230191 , air cleaner filter sec 32 cm length 15 cm width nk , fuel filter element pre filter 9451037404 001200240911 , fuel filter micro star type 9451037405 001200240912 , oil filter turbocharger d10108880 , oil filter ek6087 6054118 point 8 point 0009 , fuel filter 9188 818 , air filter pre 32 cm length 15 cm width nk , air filter sec 30 cm length 07 cm width nk , fuel filter f002h20364 , fuel pipe bitumin burner nk , bearing 6207rs , glan dori nk , float ball water tank 50 mm nk , pvc insulated 4 core aluminium xlpe cable size 50 sq mm nk , pvc insulated 4 core aluminium xlpe cable size 35 sq mm nk bid number/ ( ( ) ): gem/2024/b/5590341 dated/* : 09-11-2024 bid document/ 2 1 / 34

CTN :38163240 Due date: 29 Nov, 202429 Nov, 2024 NA
Tender For supply of re 05 medicines - inj adenosine 3 mg per ml 2 ml , inj adrenaline tartrate 1 isto 1000 1 ml , inj amiodarone hcl 150mg 3ml , inj atracurium 10 mg per ml 2.5 ml amp , inj dexamethasone sodium phosphate 4.4 or 4 mg per ml 2 ml , inj diazepam 10 mg 2 ml , inj diclofenac sodium 25 mg per ml 3 ml , inj dicyclomine hcl 20mg , inj digoxin 0.5 mg 2 ml , inj hydrocortisone , inj hyoscine bromide 20 mg per ml 1ml , inj ketamine hcl 50 mg per ml 2 ml , inj labetalol 5mg per ml , inj levetiracetam 100 mg per ml vial of 5 ml , inj lorazepam 2 mg per ml 2 ml inj , inj metoclopramide5mg per ml , inj metoprolol 1 mg per ml 5 ml , inj morphine 15 mg per ml , inj multivitamin , inj neostigmine 0.5 mg 1 ml , inj nitroglycerine 5 mg , inj pheniramine maleate 22.5 mg per ml , inj phenytoin sodium 100 mg , inj ranitidine hcl 50 mg 2 ml , human rabies immuneglobulin 150 iu per ml 2ml vial , tab amiloride 10mg and frusemide 40mg , tab atenolol 50 mg and amlodipine 5mg , tab bisacodyi 5 mg , tab dapagliflozin 10 mg , tab dexamethasone 4 mg , tab glimepride 2 mg , tab loperamide 2mg , tab mefenamic acid and dicyclomine 10mg , tab metoprolol xl 50 mg , tab naproxen 250 mg , tab nicorandil 10 mg , tab nitrofurantoin 100mg , tab nitroglycerin 2.6 mg , tab nortriptyline 25 mg , tab pentoxyphyllin 400 mg , tab rosuvastatin 20 mg , tab sitagliptin 100mg , tab spironolactone 50 mg , tab ticagrelor 75 mg , tab trypsin chymotrypsin , tab vildagliptin 50 mg and metformin 500 mg , tab warfarin 2mg , tab calcium carbonate 500mg elemental and vit d 3 200iu to 250iu , cap tramadol hcl 50 mg , cap vitamin b complex becosule , bromhexine syp 5 ml bottle of 100 ml , cough expectorant syp 5 ml containing diphenhydramine hcl 14.08mg ammonium chloride 0.138 gm sodium citrate 57.03mg menthol 1.14 mg in flavoured syp base bott of 100 110 ml , lactulose syp each 5ml containing 3.325g bott of 100 ml , liq antacid gel bottle of 400 ml , napkin absorbent dental disposable pkt of 500 , oint povidone iodine , rolls absorbent cotton dental assorted sizes in box of 500 , digital x ray film for computerised radiography 8 x 10 fujifilm pack of 150 , gauge ribbon dental 1 inch x 100 mtr bid details/ 2 / 45

Central Government And Public Sector

CTN :37986105 Due date: 09 Dec, 202409 Dec, 2024 3.51 Lacs
Tender For corrigendum : providing of custom bid for services - annual maintenance contract of 3x500 kva and 1x200 kva cummins make dg sets installed at power housedam site and samdong

CTN :38320431 Due date: 26 Nov, 202426 Nov, 2024 NA
Tender For supply of pa speaker (q2) , public address (pa) amplifier (v2) (q2) , microphone (q2) , speaker cable (q3)

Central Government/Public Sector

CTN :38308048 Due date: 02 Dec, 202402 Dec, 2024 NA
Tender For supply of digital earth resistance meter as per is 9000 (q3)

CTN :38321509 Due date: 30 Nov, 202430 Nov, 2024 2.36 Lacs
Tender For construction of high-altitude hill road to indo china border from kerang (altitude 16721 ft.) to oloten (altitude 18053 ft.) having length 12.70 km in the state of sikkim under phase-ii. sh: providing services of computer operator, peon-mts, sweeping -cleaning in the office of ee, border road project division-i & sub division office, cpwd, chungthang, north sikkim.

CTN :38305164 Due date: 13 Dec, 202413 Dec, 2024 NA
Tender For supply of injector nozzle tata safari storme
 Loading, Please wait...

Connect us via What's Up