Acetaldehyde Tenders

Get complete information related to latest Acetaldehyde Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Acetaldehyde Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Acetaldehyde Tenders .

Filter

Loading....

Get Tender in Email

CTN :39983520

24 Apr, 2025 8.22 Lacs

Bhopal - Madhya Pradesh

Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

CTN :39920637

25 Apr, 2025 7.90 Lacs

Amritsar - Punjab

Tender For supply of inj dobutamine 12.5 mg , mefenemic acid 250 mg plus dicyclomine hydrochloride 10 mg tab , quinine 300mg tab , levodopa 125 mg tab , topiramate 50mg tab , ethamsylate 250 mg tab , rivaroxaban 20 mg tab , mannitol 20 percent 100 ml bottle , benzocaine 20 percent pectin based oral ointment tube of 5 gm , triamcinalone acetonide 0.1 per for oral use tube of 5gm , cream silver sulphadiazine 1percent w v jar of 500 gms , triamcilone 10 mg inj , lignocaine 2.5 percent plus prilocaine 2.5 percent tube of 30gm , ear drop para dichlorobenzene 2 percent wv benzocaine 2.7 w v chlorbutol 5 percent turpentine oil 15 percent w v bott of 10ml clear wax , povidone iodine 7.5 percent solution 100 ml , 2 propanol 45 percent w w 1 propanol 30 percent w w ethyl hexadecyl dimethyl ammonium ethylsulphate mecetronium ethyl sulfate 0.2 percent w w bott of 500 ml brand bactorub blue raman and well , chloroxylenol solution potassium hydroxide 13.6 g chloroxynol soln 50.5g oleic acid 7.5ml castor oil 63.0g terpineal 100ml ethanol 96 pernt 200ml to rwc not les thn 3 dettol

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Acetaldehyde Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector