Aluminium Carbonate Tenders

Get complete information related to latest Aluminium Carbonate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Aluminium Carbonate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Aluminium Carbonate Tenders .

Filter

Loading....

Get Tender in Email

CTN :39983520

24 Apr, 2025 8.22 Lacs

Bhopal - Madhya Pradesh

Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

State Government

CTN :39926120

22 Apr, 2025 NA

Multi City - Andhra Pradesh

Tender For procurement and supply of medicines - halothane for inhalation (contains halothane bp), 250ml phenytoin sodium injection ip 50mg/ml in, 5ml vial 5-fluorouracil injection ip 250 mg /5 ml in 5 ml, amp mephentramine, sulphate injection 30, mg /ml in 10 ml vial, salbutamol nebuilising, solution ip 10ml, labetalol hcl injection ip, 5mg / ml in 10ml vial, adenosine injection ip, 3mg / ml 2ml vial or, ampoule, bupropion hcl tablets, 150 mg usp, cyclosporine capsules, usp 25 mg, flutamide tablets usp, 250 mg, ichthymol 1.5gm, glycerine upto 15ml nfl, iii, methimazole tablet 5mg, methotrexate tablets ip, 2.5 mg, methotrexate injection, ip 50 mg / ml in 2ml, amp, valthemine bromide, injection 8mg /ml., fluconazole for oral, suspension 50mg per, 5ml (pack size : 35ml), 5-fluorouracil injection, ip 500 mg/10 ml in, 10ml amp, barium sulfate, suspension 100% w/w, 340 gms, calciferol oral drops 75, mcg/ml 20 ml, ropivacaine injection, 0.75mg%, 10ml vial, benzathene penicillin la, 12 lakh injection 1 gm /, vial, canagliflozin tablet, 100mg, capd (continuous, ambulatory peritoneal, dialysis) solution set, 4.25%, 2 litres bag with, integrated asymmetric, y. set, tab.orciprenaline 10mg, tab.propylthiouracil 50, mg, tab.pentoxiphylline, 400mg, sodium chloride, solution for irrigation, 0.9%-5ltr, tab.azathioprine 100mg, inj.basal insulin, analogues 300 iu/ml, betoxolol eye drops, 0.50%, biosaftey liquid -4, solution-5ltr, tab.cyclosporine, 200mg, cap formetrol fumerate, inhalation 6mcg, tab.cyclosporine 100mg, inj.etomidate 2 mg /ml,, 20mg/10 ml vial, gatifloxacin eye, ointment 0.3%, inj.hyperbaric, levobupivacaine 0.5/4, ml amp, inj butorphanol 2 mg,, amp for im/iv, inj carbetocin 100, mcg/ml, inj lidocaine 2%, preservative free 50 ml, multi dose vial, inj phenylephrine 2ml, inj.levobupivacaine, isobaric 0.5/20 ml vails, tab.levonorgestrel, releasing intrauterine, 52mg, tab.mifepristone 10mg, papain ip 521700, units, urea ip 100mg, ointment 1%w/w,, 100gms tube, paracetamol, suppositories 80mg, podophyllin resin 20%, tab.racecadotril 100mg, salcylic acid+lactic acid, oint 6% 30 gr, soda lime crystals 5kg, tins, sodium phosphate 10, gm enema pack 100ml, tab.cintapride 1mg, tab.methyl phenidate, hydrocloride 18mg, hydrocortisone acetate, 10% w/w oint 20.8 gm, barium sulphate, powder 1kg, tab.cepodoxime 500mg, tab.feropenam 200mg, inj.sugammadex 100, mg/5ml vial, inj terlipressin, 0.12mg/ml (1mg in, 8.5ml), tab.atamoxetin 10 mg, inj nicrondil 4mg, cardioplegia solution, 20ml inj, inj l ornithine l, apartate-5g/10ml, cap.valgancyclovir, cap.l-ornithine, l-aspartate, silymarin, grap seed extract,, nicotinamide capsule, 150mg:70mg, warfarin sodium tablets, ip 3 mg, cap.levosalbutamol, respule 0.63mg/3ml, non-ionic, contrast-gadotridol, 0.5m 10ml/15ml, non-ionic, contrast-iomeprol, 400mg 50ml/100ml, oral contrast-sodium, diatrizoate 25%, 30ml/100ml, tab.morphine sulphate, 10mg, ethamsylate injection, 125mg/ml 2 ml ampoule, nitroglycerine (n.t.g.), injection 5mg/ml in 5 ml, octreotide injection, 100mcg/ml, carbimazole tablet, 10mg, cefixime tablets ip 200, mg, paclitaxel injection ip 30, mg / 5 ml, carboplatin 450mg / 45, ml injection vial, amoxicillin capsules ip, 500 mg, azithromycin tablets ip, 500 mg, antisnake venom, injection, isosorbide dinitrate, tablets 10mg, carbimazole tablets, 20mg, quetiapine 25mg tablet, ketorolac tromethamine, injection 30mg /ml, 1 ml, ampoule, furosemide tablets ip, 40mg, olanzapine tablets 5 mg, natamycin eye drops, 5%w/v, escitalopram tablets, 5mg, pregabalin sr tablet, 75mg, furosemide injection , ip, 10mg/1ml in 2 ml amp, dobutamine hcl for, injection usp 250mg /, 20 ml vial, tab.entecavir 1mg

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Aluminium Carbonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector