Latest aminoundecane Tenders | Government aminoundecane Tenders

CTN :39983520

24 Apr, 2025 8.22 Lacs

Bhopal - Madhya Pradesh

Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

CTN :40004516

03 May, 2025 6.53 Lacs

Aurangabad-Mh - Maharashtra

Tender For supply of tab , roller bandage 6 cm x 4 mtr , rosuvastatin 10 mg tab , rosuvastatin 20 mg tab , rotacap formoterol 6 mcg and budesonide 200 mcg bott of 30 caps , rotacap formoterol 6 mcg and budesonide 400 mcg bott of 30 caps , rotahaler device , saccharomyces boulardil 250 mg cap econorm , sacubitril 24 mg and valsartan 26 mg tab , sacubitril 49 mg and valsartan 51 mg tab , salbutamol 100 mcg inhaler , salmeterol 25 mcg and fluticasone 125 mcg inhaler , salmeterol 50 mcg and fluticasone 250 mcg rotacaps bott of 30 cap , saroglitazar 4 mg tab , scalp vein set with luer fitting of disposable plastic size 22 g blister pack , serratiopeptidase 10 mg tab , sertraline 25 mg tab , sertraline 50 mg tab , sildenafil citrate 50 mg tab , silicon heel cushion , silodosin 4 mg tab per cap , silodosin 8 mg tab , simethicone 80 mg and activated charcol 250 mg tab , simvastatin 20 mg tab , sitagliptin 50 mg and metformin 1000 mg tab , sitagliptin 50 mg and metformin 500 mg tab , sitagliptin phosphate 50 mg tab , sodium bicarbonate 1000 mg tab , sodium bicarbonate 500 mg tab , sodium chloride solution isotonic in nontoxic disposable plastic bottle , sodium hyaluronate 1 percent w per v eye drop bott of 5 ml , sodium lactate compound solution ringer lactate solution in nontoxic , sodium valproate 200 mg per 5ml oral sol bott of 100 ml , sodium valproate 500 mg tab , sofosbuvir 400 mg and velpatasvir 100 mg tab , solifenacin 5 mg tab , sorafenib 200 mg tab , spironolactone 50 mg tab , sucralfate suspension 1gm per 5ml bott of 200 ml , sulphamethoxazole 400 mg and trimethoprim 80 mg tab , sulphasalazine 1000 mg delayed release tab , syringe disposable plastic sterile 2 ml with needle , syringe disposable plastic sterile 5 ml with needle , tacrolimus 0.5mg cap , tacrolimus 1mg cap , tamsulosin hcl 0.4 mg cap per tab , tapentadol 50 mg tab , taurine 500 mg and acetylcystine 150 mg tab , telmisartan 20 mg tab , telmisartan 40 mg tab , teneligliptin 20 mg tab , tenofovir 300 mg tab , tenofovir alafenamide 25 mg tab , terbinafine 1 percent bott of 20 ml lotion , terbinafine hcl 250 mg tab , thiocolchicide 4 mg cap , thyroxine 50 mcg tab , thyroxine sodium 100 mcg tab , thyroxine sodium 12.5 mcg tab , thyroxine sodium 25 mcg tab , thyroxine sodium 75 mcg tab , timolol 0.5 mg and brimonidine 0.2 percent eye drop bott of 5 ml , timolol maleate eye drops 0.5 percent bott of 5 ml , tiotropium bromide 9 mcg 120 metered doses per unit inhaler , tobramycin sulfate 0.3 percent eye drop bott 5 ml , tofacitinib 5 mg tab , tolvaptan 15 mg tab , topiramate 25 mg tab , torsemide 10 mg and spironolactone 50 mg tab , torsemide 10 mg tab , torsemide 20 mg tab , torsemide 5 mg tab , tramadol hcl 50 mg cap per tab , tramadol hcl 50 mg per ml inj 1 ml amp , tranexamic acid 500 mg and mefenamic acid 250 mg tab , travoprost 0.004 percent w per v eye drop bott of 2.5 per 03 ml , triamcinolone 0.1 percent oral paste tube of 10 gm , trifluoperazine 5 mg tab , trihexyphenidyl hcl 2 mg tab , trimetazidine mr 35 mg tab , trimethoprim 100 mg tab , trypsin with chymotrypsin tab , u drain male incontinence device external catheter 30 mm , urea cream urea 10 to 12 percent lactic acid 5 to 10 percent in pack of 50 gm , urine collecting bag with volume meter , ursodeoxycholic acid 150 mg tab , verapamil 40 mg tab , vildagliptin 50 mg tab , vit d3 60000 iu per 1gm sachet , vitamin b complex with a minimum concentration of vit b1 5mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 2 mg tab , zolpidem 5 mg tab , hiv i and ii rapid test kit kit for 1x50 tests , kits for estimation of bid details/ 2 / 119 cholestrol erba 5x30 ml liquid fom , kits for estimation of glucose erba 200x2 ml , kits for estimation of urea erba 4x24 per 4x6 ml liquid fom , kits for estimation of uric acid erba 5x10 ml liquid fom , kits for estimation of sgot ast erba 4x24 per 4x6 ml liquid fom , kits for estimation of sgpt alt 4x24 per 4x6 ml liquid fom , kit for triglyceride estimation erba 5x10 ml liqu

State Government

CTN :39926120

22 Apr, 2025 NA

Multi City - Andhra Pradesh

Tender For procurement and supply of medicines - halothane for inhalation (contains halothane bp), 250ml phenytoin sodium injection ip 50mg/ml in, 5ml vial 5-fluorouracil injection ip 250 mg /5 ml in 5 ml, amp mephentramine, sulphate injection 30, mg /ml in 10 ml vial, salbutamol nebuilising, solution ip 10ml, labetalol hcl injection ip, 5mg / ml in 10ml vial, adenosine injection ip, 3mg / ml 2ml vial or, ampoule, bupropion hcl tablets, 150 mg usp, cyclosporine capsules, usp 25 mg, flutamide tablets usp, 250 mg, ichthymol 1.5gm, glycerine upto 15ml nfl, iii, methimazole tablet 5mg, methotrexate tablets ip, 2.5 mg, methotrexate injection, ip 50 mg / ml in 2ml, amp, valthemine bromide, injection 8mg /ml., fluconazole for oral, suspension 50mg per, 5ml (pack size : 35ml), 5-fluorouracil injection, ip 500 mg/10 ml in, 10ml amp, barium sulfate, suspension 100% w/w, 340 gms, calciferol oral drops 75, mcg/ml 20 ml, ropivacaine injection, 0.75mg%, 10ml vial, benzathene penicillin la, 12 lakh injection 1 gm /, vial, canagliflozin tablet, 100mg, capd (continuous, ambulatory peritoneal, dialysis) solution set, 4.25%, 2 litres bag with, integrated asymmetric, y. set, tab.orciprenaline 10mg, tab.propylthiouracil 50, mg, tab.pentoxiphylline, 400mg, sodium chloride, solution for irrigation, 0.9%-5ltr, tab.azathioprine 100mg, inj.basal insulin, analogues 300 iu/ml, betoxolol eye drops, 0.50%, biosaftey liquid -4, solution-5ltr, tab.cyclosporine, 200mg, cap formetrol fumerate, inhalation 6mcg, tab.cyclosporine 100mg, inj.etomidate 2 mg /ml,, 20mg/10 ml vial, gatifloxacin eye, ointment 0.3%, inj.hyperbaric, levobupivacaine 0.5/4, ml amp, inj butorphanol 2 mg,, amp for im/iv, inj carbetocin 100, mcg/ml, inj lidocaine 2%, preservative free 50 ml, multi dose vial, inj phenylephrine 2ml, inj.levobupivacaine, isobaric 0.5/20 ml vails, tab.levonorgestrel, releasing intrauterine, 52mg, tab.mifepristone 10mg, papain ip 521700, units, urea ip 100mg, ointment 1%w/w,, 100gms tube, paracetamol, suppositories 80mg, podophyllin resin 20%, tab.racecadotril 100mg, salcylic acid+lactic acid, oint 6% 30 gr, soda lime crystals 5kg, tins, sodium phosphate 10, gm enema pack 100ml, tab.cintapride 1mg, tab.methyl phenidate, hydrocloride 18mg, hydrocortisone acetate, 10% w/w oint 20.8 gm, barium sulphate, powder 1kg, tab.cepodoxime 500mg, tab.feropenam 200mg, inj.sugammadex 100, mg/5ml vial, inj terlipressin, 0.12mg/ml (1mg in, 8.5ml), tab.atamoxetin 10 mg, inj nicrondil 4mg, cardioplegia solution, 20ml inj, inj l ornithine l, apartate-5g/10ml, cap.valgancyclovir, cap.l-ornithine, l-aspartate, silymarin, grap seed extract,, nicotinamide capsule, 150mg:70mg, warfarin sodium tablets, ip 3 mg, cap.levosalbutamol, respule 0.63mg/3ml, non-ionic, contrast-gadotridol, 0.5m 10ml/15ml, non-ionic, contrast-iomeprol, 400mg 50ml/100ml, oral contrast-sodium, diatrizoate 25%, 30ml/100ml, tab.morphine sulphate, 10mg, ethamsylate injection, 125mg/ml 2 ml ampoule, nitroglycerine (n.t.g.), injection 5mg/ml in 5 ml, octreotide injection, 100mcg/ml, carbimazole tablet, 10mg, cefixime tablets ip 200, mg, paclitaxel injection ip 30, mg / 5 ml, carboplatin 450mg / 45, ml injection vial, amoxicillin capsules ip, 500 mg, azithromycin tablets ip, 500 mg, antisnake venom, injection, isosorbide dinitrate, tablets 10mg, carbimazole tablets, 20mg, quetiapine 25mg tablet, ketorolac tromethamine, injection 30mg /ml, 1 ml, ampoule, furosemide tablets ip, 40mg, olanzapine tablets 5 mg, natamycin eye drops, 5%w/v, escitalopram tablets, 5mg, pregabalin sr tablet, 75mg, furosemide injection , ip, 10mg/1ml in 2 ml amp, dobutamine hcl for, injection usp 250mg /, 20 ml vial, tab.entecavir 1mg

State Government

CTN :39965272

29 Apr, 2025 NA

Thiruvananthapuram - Kerala

Tender For supply of immun blot pvdf membrane - hisep tm lsm1077 , tris base , tris glycine sds buffer , immun blot pvdf membrane , clarity ecl substrate , precision plus protein , sodium dodecyl sulfate

Central Government And Public Sector

CTN :39711374

29 Apr, 2025 4.97 Crore

Belgaum - Karnataka

Tender For corrigendum : tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spar

CTN :39881293

22 Apr, 2025 9.49 Lacs

Darjeeling - West Bengal

Tender For supply of d ifa re 13 decapeptide 10mg lot 10ml bott , d ifa re 13 diphtheria tetanus acellular pertussisdtap single dose vaccine , d ifa re 13 inj gadobutrol 1dot0mmolml 10ml vial , d ifa re 13 umbilical catheter 3dot5 fr , d ifa re 13 tracheostomy tube 8mm with cuff and two inner cannula , d ifa re 13 sodium perborate monohydrate 50 ww solution parasafe , d ifa re 13 inj noval rabies monoclonal antibody containing docaravimav and miromavimab 1500iu2dot5ml , d ifa re 13 locking reconstruction plate 3dot5mm titanium 14 hole with twelve 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 10 hole with ten 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 12 hole with twelve 3dot5mm locking head screws , d ifa re 13 neonatal central venous triple lumen catheter central line size2dot5fr , d ifa re 13 cpap disposable tubing with water chamber and humidifier chamber , d ifa re 13 bipolar marryland vessel sealer 5mm , d ifa re 13 neonatal central venous triple lumen catheter central line size3dot0fr , d ifa re 13 endopath endoscopic bowl clamp with ratchet , d ifa re 13 disposable perforator for craniotomy atraumatic tip 14mm , d ifa re 13 thalidomide 100mg cap , d ifa re 13 antimicrobial skin cleaning wipes polyhexanide based pack of 1012 wipes , d ifa re 13 vitb complex forte with ascorbic acid cap , d ifa re 13 cyclosporine 50mg tabcap , d ifa re 13 thiocolchicoside 4mg captab , d ifa re 13 vit d3 100 iu folic acid 1mg mayoinositol 2000mg sachet5 gm each pack of 30 , d ifa re 13 glycolic acid 6 cream 30 gm tube , d ifa re 13 octinoxateniacinamideglycolic acid 3kojic acid dipalmitatearbutinmulberry extract1 tocopheryl acetateallantoinlicoric extract tetrahydrocurcumin30gm , d ifa re 13 crystal trichloroacitic acid 100 , d ifa re 13 gel sunscreen gel spf40 60gmoctinoxatediethylamino hydrobenzoyl hexyl benzoatebisethyloxyphenol methoxyphenyl microfine , d ifa re 13 hair rremoval contains watermineral full nomenclature in pdf format , d ifa re 13 hand disinfectant 32dot5 gm propanolol1 18 gm etahol 0dot1 gm glutaraldehyde bott of 250 ml liq , d ifa re 13 liquid disinfectant each 05 lit contains sodium chloride 605 gm potassium chloride 10 gm sod bi carbonate 15 gm in buffer solution qs and stabilizer qs can of 5 ltrsterisol , d ifa re 13 betamethasone 0dot05 zinc sulfate 0dot5 lotion 50ml bott , d ifa re 13 desonide 0dot05 ww gel 20gm , d ifa re 13 paracetamol 500mg caffeine 65mg tab , d ifa re 13 neomycin pulv bott 5 gm , d ifa re 13 serum vit k under eye serum 30 ml , d ifa re 13 ketoconazole ichthyal pale dpanthenol alovera 10 75ml shampoo , d ifa re 13 diazepam suppository , d ifa re 13 paracetamol 250mg suppository , d ifa re 13 surgical scrub 2 chlorhexidine in 70 ethyl alcohol without any moisturizers bott of 500 ml , d ifa re 13 cefpodoxime oral suspension , d ifa re 13 ofloxacin orinidazole syp 30 ml bottle , d ifa re 13 oseltamivir 12mgml syp , d ifa re 13 alfuzocin 10mg dutasteride 0dot5mg tab , d ifa re 13 amoxycillin 250mg clavulanic acid 50mg tab , d ifa re 13 calcium carbonate 250 tab , d ifa re 13 itopride 100mg tab , d ifa re 13 chlordiazepoxide 5mg clinidium 2dot5mg tab , d ifa re 13 mesalamine 200mg tab , d ifa re 13 metalozone 5mg tab , d ifa re 13 montelukast 10mg tab bid details/ 2 / 46

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Aminoundecane Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

Central Government And Public Sector

State Government

Central Government/Public Sector