Web Analytics Made Easy - StatCounter
GeM Registration
Advance Search

Ammonium Metavanadate Tenders

Get complete information related to latest Ammonium Metavanadate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ammonium Metavanadate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ammonium Metavanadate Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Get Tender in Email

Central Government/Public Sector

CTN :39731102 Due date: 17 Apr, 202517 Apr, 2025 3.08 Crore
Location: Gorakhpur - Uttar Pradesh Gorakhpur - Uttar Pradesh
Tender For bid to ras tender for supply of lime , alum , sodium chlorite , polyelectrolyte , oxygen scaveneger

Central Government/Public Sector

CTN :40026870 Due date: 28 Apr, 202528 Apr, 2025 NA
Location: Mumbai - Maharashtra Mumbai - Maharashtra
Tender For different types of consumables chemical items utilize in etp plant. one set consists of followi ng items.1) alum powder-32 kg 2) polyelectrolyte 7 kg 3) lime powder- 32 kg 4) tri sodium phosphate 7 kg 5) poly aluminum chloride 7 kg. supplier should submit material test certificate & material safety data s heet along with supply. during delivery the validity/expiry date of material shall be one year and above. [ warranty period: 30 months after the date of delivery ]

State Government

CTN :39948093 Due date: 24 Apr, 202524 Apr, 2025 NA
Location: Jharsuguda - Odisha Jharsuguda - Odisha
Tender For corrigendum : supply of polyelectrolyte - anionic (q3)

Central Government / Public Sector

CTN :39920193 Due date: 18 Apr, 202518 Apr, 2025 NA
Location: Panipat - Haryana Panipat - Haryana
Tender For supply of polyelectrolyte cationic

State Government

CTN :39948004 Due date: 17 Apr, 202517 Apr, 2025 NA
Location: Jharsuguda - Odisha Jharsuguda - Odisha
Tender For supply of polyelectrolyte (ongc) (q3)

corporations/Associations/Others

CTN :39957342 Due date: 25 Apr, 202525 Apr, 2025 14.59 Lacs
Location: Etah - Uttar Pradesh Etah - Uttar Pradesh
Tender For procurement of hydrated lime and polyelectrolyte for emcd-xvi (water chemistry), 2x660 mw, jtpp malawan, etah

CTN :39858271 Due date: 17 Apr, 202517 Apr, 2025 NA
Location: Netanar - Chhattisgarh Netanar - Chhattisgarh
Tender For supply of chemical polymer , ro antiscalant , dewatering polyelectrolyte , non oxidizing biocide

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Location: Kangra - Himachal Pradesh Kangra - Himachal Pradesh
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
 Loading, Please wait...

Connect us via What's Up