Web Analytics Made Easy - StatCounter

Biomedical Equipments Tenders

Get complete information related to latest Biomedical Equipments Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Biomedical Equipments Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Biomedical Equipments Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :42476610 Due date: 18 Nov, 202518 Nov, 2025 25.00 Lacs
Tender For supply of bead pro tubes 2ml 50 reaction,shredder 250 reaction,magnetic beads for nucleic acid purification 400 ml,dna cleanup kit for environmentalcomplex samples 50 reaction,twist universal adapter system truseq compatible 96 samples plate,ampure pb bead size selection kit,high molecular weight dna extraction kit 96 reaction,inhibitor removal kit 50 reaction,100 bp dna ladder ready to use 50 ugml 125 lanes,1 kb dna ladder 50 ugml 125 lanes,repair mix for ffpe 96 reaction,recombinant albumin molecular biology grade 12 mg,dna repair mix 150 reaction,gel and pcr clean up kit 250 reaction,whole genome amplification kit 50 reaction,multiple displacement amplification kit 100 reaction,exonuclease sap reagent 500 reaction,nucleic acid purification kit for sequencing 250 reaction,hot start dna polymerase 200 u,kits for hmw dna extraction from animal tissues 24 reactions,reagents to complete depletion size selection of dna 10 kb,reagents to complete depletion size selection of dna 25 kb

Central Government/Public Sector

CTN :42283512 Due date: 04 Nov, 202504 Nov, 2025 NA
Tender For supply of 100 bp dna ladder dye plus , 50 bp dna ladder dye plus , 10bp dna ladder dye plus , rnase a 50 mg , proteinase k 100 mg , tris acetate edta buffer tae 50x powder ph8 3 , tris borate edta buffer tbe powder ph8 3 , tris edta buffer te 10x powder ph7 4 , 6x loading dye , rnase free water 1000 ml , dna off dna destroys agent surfac clining , ethidium bromide , tween 20 , edta disodium salt , edta , sodium dodecyl sulfate sds , phenol , ethanol mb grade , mercaptoethanol , polyvinylpyrrolidone pvp , chloroform ar acs grade , sodium acetate , sulphuric acid ar acs grade assay min 98 pack of 2 5 ltr in glass bottle nabl iso iec 17025 2017 certificate required , nitric acid ar acs grade assay 68 70 pack of 2500 ml in glass bottle nabl iso iec 17025 2017 certificate required , ammonium molbdate ar grade assay min 99 pack of 250 g , dimethyl sulphoxide dmso ar grade 99 pack of 500ml , tris buffer ar acs 99 9 pack of 500g , tris hydrochloride tris hcl assay 99 pack of 500g , sodium chloride acs grade assay 99 9 pack of 500g , perchloric acid 70 ar acs grade assay min 70 pack of 500 ml in glass bottle nabl iso iec 17025 2017 certificate required , agarose molecular biology grade white to off white powder moisture content 8 gel strength g cm2 1200 min dnase rnase protease none detected pack of 500g , cetyltrimethyl ammonium bromide ctab assay 99 pack of 500 g , phenol chloroform isoamyl alcohol 25 24 1 ph 8 0 , fe hedta n 2 hydroxyethyl ethylenediaminetriacetic acid extrapure 99 iron fe content 12 14 pack of 500 g , isopropanol acs grade assay 99 5 pack of 1 ltr , tris saturated phenol ph 8 mb grade dnase rnase protease not detect pack of 100ml , pcr grade extrapure mgcl2 25 mm pack of 10 ml , taq dna polymerase 10x buffer with mgcl2 5u ul 5000u the polymerase is supplied with separate tubes of buffer mg2 plus and dntps pack of 250ulx20 , tris buffer ar acs for molecular biology 99 9 assay 99 9 pack of 1kg , sodium hydroxide naoh acs grade , dithiothreitol dtt if working with protein sensitive dna extractions

Central Government/Public Sector

CTN :42291516 Due date: 04 Nov, 202504 Nov, 2025 NA
Tender For supply of solution 100mm , mem non essential amino acids solution 100x , 1n hydrochloric acid solution sterile filtered 10 x 20 ml , parafilm m sealing film 100mm 38mtr dimension mm 132x135x112 , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 22um 25mm diamtere with prefilter sterile , syringe driver filters cellulose acetate hydrophilic membrane pore size 0 45um 25mm diamtere with prefilter sterile , sterifast in 500ml dispenser bottle w pump , hishield hand wash in 1 lit can pack , germitol 5 lit can pack , steriswift disinfectant wipes size 6x8 , glycerol 1 2 3 propanetriol for molecular biology , calcium chloride anhydrous cell culture tested , luria bertani agar miller , tryptone soya agar casein soyabean digest agar , tryptone soya broth soyabean casein digest medium , magnesium chloride anhydrous grade 100g molecular biology grade , polyethylene glycol average mol wt 3 350 250g , colchicine 1g , nuclease free water 10x50ml depc treated for molecular biology , glutaraldehyde solution 25 in h2o , whatman quantitative filter papers ashless grade 589 1 black ribbon circles diam 185mm pack of 100 , acetic acid glacial 100 anhydrous for analysis emsure , filter tip in rack 200ul 96 tips x 10 racks x 10 packs box , filter tip in rack 1000ul 96 tips x 6 racks x 10 packs box , serological pipette crystal grade polystyrene ps sterile individually packed 5ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 10ml pieces sleeve 1 pieces inbox 100 pieces case 400 , serological pipette crystal grade polystyrene ps sterile individually packed 25ml pieces sleeve 1 pieces inbox 100 pieces case 400 , cryovial externally threaded clear total volume 1 2ml packed in 50 500 sterile , alkalinity total for 50 tests , calcium hardness for 50 tests , hardness for 50 tests , magnesium for 50 tests , nitrate for 50 tests , nitrate n for 50 tests , nitrate nano2 for 50 tests , ph phenol red for 50 tests , phosphate lr for 50 tests , potassium for 50 tests , sulfate for 50 tests , staphylococcus aureus atcc 25923 , staphylococcus aureus subsp atcc 29213 , staphylococcus aureus subsp atcc 43300 , k pneumoniae atcc 700603 , k pneumoniae atcc baa 1705 , e coli atcc 25922 , coagulase plasma from rabbit , tryptone broth w 10 nacl , baird parker agar medium , alkaline peptone water , ec broth , ampicillin dextrin agar base , potato dextrose agar , potato dextrose broth , levine eosin methylene blue agar medium , glucose peptone agar , chloramine t hydrate , oxytetracycline dihydrate , d galactose , d mannitol , d mannose , d xylose , inositol , dulcitol , l rhamnose monohydrate , d sorbitol , d raffinose pentahydrate , d trehalose dihydrate , adonitol , d salicin , d melibiose monohydrate , esculin fermentation broth , gelatin hi lr , sodium hydroxide , simon citrate agar , sm agar , sim medium , starch agar , indole nitrate medium , urea agar base , glucose of medium , phenol red broth base , mr vp medium buffered glucose broth , dnase test agar w methyl green , triple sugar iron agar , ornithine decarboxylase broth , lysine decarboxylase broth , arginine dihydrolase broth , glycerol hi ar , tryptone soya broth soyabean casein digest medium , esculin agar , muller hinton agar , gram stains kit , durham tubes , o gene ruler 1kb dna ladder , o gene ruler 100bp dna ladder plus , taq dna polymerase recombinant 5 u ul , dntp mix 10mm each , water nuclease free molecular biology grade , 6x loading dye solution , lysozyme , storage vial self standing pp with hdpe closure , cryo babies , laser cryo babies , tough tags //bid details 2 / 122 , spinwin tube conical bottom pp with hdpe closure 15 ml , slid box ps , autoclavable bags pp , sample bags ldpe , beaker pmp , beaker pp , sodium hippurate , acetone , 1 butanol , ninhydrin , tagatose , dnase test agar , nutrient gelatin agar , triple sugar iron agar , phenol red dextrose broth , phenol red sucrose broth ,

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42228337 Due date: 31 Oct, 202531 Oct, 2025 6.22 Lacs
Tender For supply of sodium azide mb grade , silver nitrate 0 1 n solution , sodium chloride , sodium molybdate dihydrate , sodium nitrite mb grade , sodium sulphate anhydrous , 3 m sodium acetate ph 5 2 mb grade , sodium dihydrogen phosphate dihydrate , sodium hydroxide , sodium carbonate anhydrous acs 99 9 minimum purity , sodium diethyldithiocarbamate trihydrate acs minimum purity 99 , sucrose pure , sulfuric acid pure hi ar , sulphanilamide hi ar , 5 sulphosalicylic acid 3 , sulfosalicylic acid dihydrate extra pure , 2 3 5 triphenyl tetrazolium chloride , 2 thiobarbituricacidtba extrapurear 99 , 40x tae buffer hi grade , 10x tbe buffer , 5x t4 dna ligase buffer , tembotrione metabolite , tetracyclin , thiourea extra pure ar , titanium dioxide , titanium chloride , toluene lr grade , tris buffer , tris hcl buffer , trizol reagent 200 ml , tris base mb grade 1 kg , tris hcl ph 8 0 1m 1000ml , triethanolaminepure 98 , trichloroacetic acid tca , triton x 100 , uridine diphosphoglucose , 2 vinylpyridine , whatman filter paper no 1 , yeast invertase , yeats hexokinase , yeast p glucose isomerase , zinc sulphate , zinc sulfate heptahydrate , dna isolation kit from plant , first strand cdna synthesis kit verso , genejet gel extraction kit , gsure rna isolation kit from pigeon pea , g9 taq dna polymerase 10x buffer with mgcl2 5u l , pcr master mix 2x , one step rt pcr kit , hi efficiency ta cloning kit , purelink rna mini kit , rapid dna ligation kit , surespin plasmid mini kit , super dh5alpha comp cell , taq dna pol 3u l including 10x buffer 25mm mgcl2 , g9 taq dna polymerase 10x buffer with mgcl2 5u ul , t4 dna ligase , trackit 100 bp dna ladder

Central Government/Public Sector

CTN :42211491 Due date: 30 Oct, 202530 Oct, 2025 NA
Tender For supply of chemical e e -macro tips 5ml , ammonium sulphate for plant tissue culture 500 gm , calcium chloride dihydrate for tissue culture 500 gm , sucrose for tissue culture 5 kg , sodium thiosulphate anhydrous extrapure ar 500 gm , agar tissue culture tested 500 gm , wide mouth bottle ldpe , wide mouth square bottle hdpe , jerrican hdpe , wash bottle new type , analytical long stem funnel pp , accupipet-starter kit , macro tips 5 ml , spinix- vortex shaker , spinwin mc-00 micro centrifuge , nitrile gloves powder free , kimwipes wipes , test tube cap pp , planton , staining box pp , biohazard bags pp , autoclavable bags pp , 5-sulphosalicylic acid dihydrate acs , tris buffer for hplc 99 9 , luria bertani broth , luria bertani agar , n-hexane pure 99 , agarose high eeo for molecular biology , citric acid anhydrous extrapure 99 , sodium bicarbonate extrapure, 99 , silica gel blue self indicating coarse 58 mesh , boric acid extrapure 99 5 , phytic acid sodium salt hydrate insp6 extrapure 70 , polyethylene glycol 6000 powder peg 6000 , isopropanol ipa for molecular biology 99 8 , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof a , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof b , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof c , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof d , longamp taq dna polymerase 500 units , q5 high-fidelity dna polymerase - 100 units , ecori - 10000 units , bamhi - 10000 units , hind- iii-hf - 10000 units , bsai-hf v2 - 1000 units , primescrip 1st strand cdna synthesis kit , e coli dh5 competent cells , e coli dh5 competent cell , mighty cloning reagent set blunt end , mighty cloning reagent set blunt end s , water nuclease free , murashige skoog medium w o sucrose agar , hwso9 , hwg09 , salicyclic acid , indole-3-acetic acid iaa , 6-aminopurine vitamin b4 , gibberellic acid ga3 , jasmonic acid , ethephon , generuler 50 bp dna ladder ready-to-use 50 g , generuler 1 kb dna ladder 5 x 50 g , dntp set 100 mm solutions 4 x 1 ml , dreamtaq dna polymerase 500 u , 6x dna loading dye 5 x 1 ml , water nuclease-free 4 x 1 25 ml , water nuclease free 30 ml , phusion high-fidelity dna polymerase 100 u , 0 510 l universal fit gentip natural, bulk low retention non sterile , 100 1000 l universal fit gentip natural, bulk bevelled low retention non sterile , 0 2ml clear 96 well pcr plate no skirt high profile , sealing mat for 96 pcr plate white , storage rack for 1 5 2 0ml tubes assorted 100 well , autoclave bags 415 x 600mm , centrifuge tube with cap conical, sterile racked , 25 well pc rack , micro tube rack 1 5 ml , digital micro pipette , tips for gensleek-10000 clear , parafilm m sealing film , silicone lab mat , magbox , cube tube rack , adapt-a-rack , floating microtube rack , sample container , carboys with stopcock , 4-layer pp activated carbon lab mask , tough-tags , thermo-labserve soft blue nitrile gloves , thermo-labserve soft blue nitrile glove , kimberly-clark purple nitrile gloves-m , safeskin purple nitrile gloves-l , ethanol molecular biology grade , autoclavable bag , accupipette 1 5ml , moisture proof bottle with inner lid 1 litre , cuvettes disposable 4ml , test tube basket 160 160 160 mm , face mask , porcelain buchner funnel , ceramic heater quartz tube-4l , double distillation unit 2 5 lph with quartz heater , ceramic //bid details 2 / 61 heater_quartz tube 2 5 l accs , circulating water bath 12 ltr , magnetic stirrers heat stir , hot plate , glass dryer

Central Government/Public Sector

CTN :42181349 Due date: 28 Oct, 202528 Oct, 2025 NA
Tender For supply of chemical - phenol 500gpk , goat anti bovine igg h l secondary antibody hrp , sheep anti bovine igm secondary antibody hrp 1mg pk , gelatin from bovine skin 500g pk , protein g peroxidase from streptococcus sp 250ug pk , o phenylenediamine dihydrochloride 100tab , rb 2x taq pcr master mix premix taq dna polymerase with dntps and buffer with green dye 500rxn , anti human igg fe specific peroxidase antibody produced in goat 1ml pk , anti human igm u chain specific peroxidase antibody produced in goat 1ml pk
 Loading, Please wait...

Connect us via What's Up