Latest blood bank reagent Tenders | Government blood bank reagent Tenders

CTN :42476610

18 Nov, 2025 25.00 Lacs

Ernakulam - Kerala

Tender For supply of bead pro tubes 2ml 50 reaction,shredder 250 reaction,magnetic beads for nucleic acid purification 400 ml,dna cleanup kit for environmentalcomplex samples 50 reaction,twist universal adapter system truseq compatible 96 samples plate,ampure pb bead size selection kit,high molecular weight dna extraction kit 96 reaction,inhibitor removal kit 50 reaction,100 bp dna ladder ready to use 50 ugml 125 lanes,1 kb dna ladder 50 ugml 125 lanes,repair mix for ffpe 96 reaction,recombinant albumin molecular biology grade 12 mg,dna repair mix 150 reaction,gel and pcr clean up kit 250 reaction,whole genome amplification kit 50 reaction,multiple displacement amplification kit 100 reaction,exonuclease sap reagent 500 reaction,nucleic acid purification kit for sequencing 250 reaction,hot start dna polymerase 200 u,kits for hmw dna extraction from animal tissues 24 reactions,reagents to complete depletion size selection of dna 10 kb,reagents to complete depletion size selection of dna 25 kb

Central Government/Public Sector

CTN :42456874

14 Nov, 2025 NA

Pondicherry - Pondicherry

Tender For supply of chemicals, consumables and kits methanol (hplc grade) , acetonitrile (suitable for gc) , perchloric acid (hplc grade) , dipotassium phosphate (mb grade) , sodium hydroxide (naoh) (mb grade) , 2,4 dnph (hplc grade) , hexane (suitable for gc) , mtbstfa (with 1% tbdmcs) , isopropanol (suitable for gc) , methoxyamine hydrochloride (derivatization grade) , sorbitol (gc) (mb grade) , tert-butyl methyl ether (suitable for gc) , d-sorbitol bioultra , succinic acid 99.0% , arginine (gc grade) , asparagine(gc grade) , glutamine(gc grade) , aluminum oxide , toluene (hplc grade) , cyclohexane (hplc grade) , ethyl acetate (hplc grade) , formic acid (hplc grade) , total rna extraction kit (pbmc) , cdna synthesis kit , sybr green based master mix , primers , depc treated water (mb grade) , trizol reagent , 100% ethanol (mb grade) , rnasezap , glass insert with spring for 1.5ml vial , 9mm blue screw caps with red silicon/ptfe beige bonded , slit septa -100/pk , 9mm blue screw caps with white silicon/ptfe beige , bonded slit septa , 100/pk , auto sampler vial 1.5ml clear - 100/pk , low volume insert, 150 l volume, with plastic spring, , 100/pk , low volume 6 x 29 mm insert, 300 l volume, with , plastic spring 100/pk , tr-5ms gc columns, 0.25 m film thickness, 0.25mm i.d., 30m length , pcr strips tubes with attached caps 0.2ml (8 tubes per strip). colorless, clear, sterile, pyrogen, dnase, rnase, human and bacterial dna-free. compatible with veriti and veriti pro (per pack 125 nos) , pcr strips tubes with attached caps 0.2ml (8 tubes per strip). optical, colorless, clear, sterile, pyrogen, dnase, rnase, human and bacterial dna-free. compatible with ab qs5 pcr system (per pack 125 nos) , optical pcr plates 200 microlitre (suitable for applied bio-system qs5) , optical adhesive cover , (suitable for applied bio-system qs5) , micropipette adjustable volume: 0.1-0.2 microlitre , micropipette adjustable volume : 2-20microlitre , micropipette adjustable volume: 0.5- 10microlitre , micropipette adjustable volume: 20-200microlitre , micropipette adjustable volume: , 100-1000microlitre , nuclease free filter tips (96 well box): 0.2 -2 l , nuclease free filter tips(96 well box): , 2-10 l , nuclease free filter tips (96 well box): , 10-100 l , nuclease free filter tips , (96 well box):100-1000 l , pp, nuclease free sterile centrifuge tubes : 0.5ml , pp, nuclease free sterile pcr tubes : 0.2ml , nitrile gloves (medium size) , sterile latex gloves (medium size) , screw cap centrifuge tube 15ml; colorless, clear, sterile, pyrogen, dnase, rnase, human and bacterial dna-free. autoclavable. medical grade pp/hdpe confirming to usp class vi (per box 500 nos) , screw cap centrifuge tube 50ml; , colorless, clear, sterile, pyrogen, dnase, rnase, human and bacterial dna-free. autoclavable. medical grade pp/hdpe confirming to usp class vi (per box 500 nos) , microcentrifuge tube, 2 ml capacity with hinged safe-lock lid. colorless, clear, sterile, pyrogen, dnase, rnase, human and bacterial dna-free. should be , graduated beaker 1000ml (plastic) , graduated beaker 500ml (plastic) , graduated beaker 250ml (plastic) , graduated beaker 100ml (plastic) , graduated beaker 50ml (plastic) , graduated beaker 10ml (plastic) , stainless steel spatula 6inch , stainless steel spatula 8inch , stainless steel spatula 12inch

CTN :42150380

01 Nov, 2025 NA

Delhi - Delhi

Tender For corrigendum : supply of conditioning reagent 3500 series catalogue no. 4393718 , hi-di formamide, 5ml 4 tube catalogue no. 4440753 , bdt v3.1 rr-100 and seq buffer each catalogue no. 4337455 , bigdye xterminator kit 20 ml each catalogue no. 4376487 , exosap-it 500 reactions catalogue no. 78201.1 ml , anode buffer container 3500 series 4 pack catalogue no. 4393927 , cathode buffer container 3500 series 4 pack catalogue no. 4408256 , pop-7 polymer for 3500 series genetic analyzers 384 samples catalogue no. 4393708 , sequencing standards bigdye terminator v3.1 3500 series catalogue no. 4404312 , ds33 matrix standard g5 kit catalogue no. 4345833 , miniseq high output kit each having 300 cycles catalogue no. fc-420-1003 , nextera dna flex library prep each having 96 samples catalogue no. 20060059 , idt dna or rna ud indexes 96 samples catalogue no. 20091654 , high sensitivity d 1000 screen tape catalogue no. 5067-5584 , high sensitivity d 1000 reagent catalogue no. 5067-5585 , loading tips 10 pk catalogue no. 5067-5599 , qubit dsdna hs high sensitivity assay kit each having 500 assays catalogue no. q32854 , qubit tm assay tubes catalogue no. q32856 , vitek ms -ds target slides, ref code - 410893 biomerieux , vitek ms - chca matrix, ref code - 411071 biomerieux , vitek ms - silica orange gel, ref code - 411721 biomerieux , e.coli atcc 8739, ref code - 0483p biomerieux ) /bid number : gem/2025/b/6733087 * /dated: 04-10-2025 & & / bid document 1 / 21

Central Government And Public Sector

CTN :42352872

07 Nov, 2025 NA

Mumbai - Maharashtra

Tender For supply of id di cell set 11 panel cell , idm liss coombs cared 288 profile , id nacl enzyme test cards , anti jka immucore , anti jkb immuucore , anti fya immucore , anti fyb immucore , qiaamp dna blood mini lit 250 qiagen , qiagen buffure al 264ml , qiagene multiplex master mix , ortho coombs reagent rm 4780

Central Government/Public Sector

CTN :42424444

14 Nov, 2025 3.21 Lacs

Hazaribag - Jharkhand

Tender For supply of phenyl mercuric acetate 25gm , potassium iodide 250gm , pepsin 1 3000 100 g , pure glycogen 5g , p nitrophenyl d glucopyranoside , pyruvic acid sodium salt 25g , 2 propanol bioreagent 500ml , quercetin dihydrate 98 25gm , reduced glutathione 5g , rochelle salt sodium potassium tarterate 500g , rnalater stabilization solution 100ml , silica gel 1 kg , sodium carbonate anhydrous hi ar 99 5 500 g , sodium carbonate na2co3 500g , sodium chloride extrapure hi ar 99 500g , sodium chloride 500 g , sodium hydroxide pellets 500 g , sodium lauryl sulphate hi ar 500 g , sulphuric acid hi ar 97 2 5 litre , silver nitrate solution 500ml , sodium citrate 3 8 w v 125ml , sodium citrate dihydrate hi ar 99 500 g , sodium bicarbonate hi lr 1 kg , sodium hypochlorite 4 w v , schaeffer and fulton s spore stains kit , sodium sulphate hi ar 500 g , sodium molybdate dihydrate hi ar 500g , sodium bicarbonate 500 gm , sodium hydroxide flakes 5kg , sodium hydrogen phosphate anhydrous 500g , safranine 10gm , sodium acetate , sodium sulphite anhydrous 500 g , sodium azide nan3 500 g , sodium hydrogen carbonate nahco3 500g , sodium sulphate 500g , starch soluble 500g , trichloroacetic acid , tri ammonium citrate 500g , tryptone es , thiosemicarbazide hi ar 100gm , tri chloro acetic acid hi ar 500 gm , 2 3 5 triphenyltetrazolium chloride 25 gm , trypan blue 0 4 solution in dulbeccos phosphate buffered saline 100ml , toluene ar 500 ml , tris free base 500g , trizol reagent 200ml , total plate count agar , ultrapure dna typing grade 50x tae buffer 1l , ultrapure ethidium bromide 10 mg ml 10 mg , vitamin a acetate powder 25gm , vitamin b1 hydrochloride 25gm , vitamin b12 1gm , vitamin b2 25gm , vitamin b3 100 gm , vitamin b5 25gm , vitamin b6 hydrochloride 25gm , vitamin b7 10 gm , vitamin c 100 gm , vitamin d3 1 gm , vitamin e 10 gm , zinc sulphate monhydrate 500g

State Government

CTN :42312003

04 Nov, 2025 NA

Delhi - Delhi

Tender For supply of dna kits and consumables c c - pop4 tm 384 catalogue no 4393715 , conditioning reagent 3500xl cat no 4393718 , cathode buffer container cat no 4408256 , anode buffer contianer cat no 4393927 , quantifiler trio cat no 4482910

CTN :42263889

06 Nov, 2025 15.00 Lacs

Aizawl - Mizoram

Tender For supply of chemicals and reagents for mls d d - dichlorophenol indophenols , 3 2 dinitrosalicyclic acid , anthrone , ascorbic acid , infusion agar , cetrimid aga , cetrimide ar , chlorine grnules , depc treated water , diphenylamine , disodium edta , dna , edta disodium , enriched thioglycollate , hydrochloric acid , l arginine , l aspartic acid , leucine , lithium chloride , l-proline , orcinol monohydrate , oxalate , oxalic acid , phenol crystals , piperacillin , rennin , rna , rotheras , sodium carbonate , sodium hydroxide pellets , sodium laureth sulfate , stannous chloride , trisbase , 2 mercaptoethanol , sodium citrate , absolute alcohol , albert metachromatic stain kit , alpha feto protein , biuret reagent , carcino embryonic antigen , cholesterol kit , ctab extraction solution , dengue combo , dnase 1 solution , erba triglycerides , esbl , ethylene glycol , fluoride solution , follicle stimulating hormone fsh , indian ink , leutinisinghormone lh , bilirubin direct , bilirubin total , cholesterol , creatinine reagent , glucose mono reagent , hdl direct reagent , ldl direct reagent , potassium reagent , sgot reagent , sgpt reagent , triglycerides reagent , urea reagent , uric acid reagent , masson trichrome stain kit , muccarmine stain solutionotto chem , n hexane , perchloric acid , phenol chloroform , povidone- iodine solution , prolactin , prostrate specific antigen , rapid h e stain kit , rapid oil red o staining kit , pearl stain kit , ribonuclease , staining solution , siver nitratelabogen , sodium hypobromite solution , sodium hypochlorite , sulfuric acid ar , sulphuric acid ar , te buffer , testosterone , thyroid stimulating hormone , trizol reagent , universal ph indicator solution , van gieson staining kit , zn stain kit , amoxyclav , aso test kit , bacitracin disc , capsule staining kit , cefadroxil , cefepime disc , cefixime clavulanic aicd , cefotaxime disc , clavulanic acid , cefoxitin disc , cefpodoxime disc , ceftazidime , ceftriaxone disc , cephalexin , ciprofloxacin , cotrimoxazole , crp test kit , distilled water , gas pack , hav igg igm rapid test , hbsag rapid test kit , hcv ab rapid test , hcv tridot test kit , hepatitis a rapid test kit , hepatitis e rapid test kit , hev igm rapid test , hiv tridot kest kit , imipenem , nitrofurantoin , norfloxacin , novobiocin disc , ofloxacin , optochin , piperacillin tazobactem , pregnancy test kit , ra test kit , rf test kit , scrub typhus test kit , tetracycline , vdrl test kit , widal test kit

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42228337

31 Oct, 2025 6.22 Lacs

Hazaribag - Jharkhand

Tender For supply of sodium azide mb grade , silver nitrate 0 1 n solution , sodium chloride , sodium molybdate dihydrate , sodium nitrite mb grade , sodium sulphate anhydrous , 3 m sodium acetate ph 5 2 mb grade , sodium dihydrogen phosphate dihydrate , sodium hydroxide , sodium carbonate anhydrous acs 99 9 minimum purity , sodium diethyldithiocarbamate trihydrate acs minimum purity 99 , sucrose pure , sulfuric acid pure hi ar , sulphanilamide hi ar , 5 sulphosalicylic acid 3 , sulfosalicylic acid dihydrate extra pure , 2 3 5 triphenyl tetrazolium chloride , 2 thiobarbituricacidtba extrapurear 99 , 40x tae buffer hi grade , 10x tbe buffer , 5x t4 dna ligase buffer , tembotrione metabolite , tetracyclin , thiourea extra pure ar , titanium dioxide , titanium chloride , toluene lr grade , tris buffer , tris hcl buffer , trizol reagent 200 ml , tris base mb grade 1 kg , tris hcl ph 8 0 1m 1000ml , triethanolaminepure 98 , trichloroacetic acid tca , triton x 100 , uridine diphosphoglucose , 2 vinylpyridine , whatman filter paper no 1 , yeast invertase , yeats hexokinase , yeast p glucose isomerase , zinc sulphate , zinc sulfate heptahydrate , dna isolation kit from plant , first strand cdna synthesis kit verso , genejet gel extraction kit , gsure rna isolation kit from pigeon pea , g9 taq dna polymerase 10x buffer with mgcl2 5u l , pcr master mix 2x , one step rt pcr kit , hi efficiency ta cloning kit , purelink rna mini kit , rapid dna ligation kit , surespin plasmid mini kit , super dh5alpha comp cell , taq dna pol 3u l including 10x buffer 25mm mgcl2 , g9 taq dna polymerase 10x buffer with mgcl2 5u ul , t4 dna ligase , trackit 100 bp dna ladder

State Government

CTN :42250113

01 Nov, 2025 93.00 Lacs

Anand-Guj - Gujarat

Tender For supply of sybr premix - tli rnas h plus , syringic acid , sinapic acid , sodium arsenate dibasic hydrate , 37 components fame mix , 2 3 5- tri phenyl tertazolium bromide , 2 4 6-tris 2-pyridyl- s-triazine , tannic acid , nnnn-tetramethyl ethylene diamine , vanilic acid , water sterile nuclease free , aflatoxin g1 , aflatoxin g2 , aflatoxin b1 , aflatoxin b2 , hemicellulase , alcalase , phytic acid assay kit , trypsin activity assay kit , 2 2-diphenyl-1-picrylhydrazyl , meta- phosphoric acid , amylose , l-amino acid assay kit , n- benzoyl-dl-arginine-p-nitroanilide bapa , trypsin - porcine pancreatic , methanol hplc grade , pancreatin , pepsin , potassium thiocyanate kscn , tannic acid standard , vanillin , tri chloro acetic acid , tris base , anthrone , hpp vessel gasket , hpp sensor probe , pectinase , cellulase , phytic acid assay kit , tannin microplate assay kit , saponin microplate assay kit , n benzoyl-dl-arginine p-nitroanilide hydrochloride , trypsin solution , phosphotungstic phophomolybdic acid , neutrase , orthophthaldehyde , 2- mercaptoethanol , l-glutathione , l-serine , ultra centrifugal filter 3 k da mwco , alpha glucosidase , ace inhibitory activity assay , indophenol dye , betacyanin , tuning and performance standards for lc ms , methyl myristate , linolenic acid methyl ester , amino acid kit , 3 5-dinitro salicylic acid reagent , p-nitrophenyl a-d-galactopyranoside , trypsin edta , acrylamide , n n-methylene bis-acrylamide , n n n n-tetramethylethylenediaamine , fluorometric , l- tyrosine , antimicrobial susceptibility test discs , mcfarland standard , phenol chloroform isoamyl alcohol , listeria monocytogenes detection kit , dna ladder 100 bp , glycine- sodium hydroxide buffer , potassium acetate , betanin , quercetin , kaempferol , 96-well polystyrene microtiter plate , indicaxanthin , 2 2-diphenyl-l-picrylhydrazyl , protein standards for electrophoresis , acarbose extrapure , tris acetate edta buffer , tris borate edta buffer , listeria monocytogenes atcc 700301 lyophilized culture , listeria monocytogenes atcc 700302 lyophilized culture , papaya mosaic virus elisa kit , papaya ringspot virus elisa kit , papaya leaf curl virus elisa kit , soybean mosaic virus elisa kit , urdbean crinkle virus elisa kit , mungbean yellow mosaic virus elisa kit , okra enation leaf curl elisa kit guide it mutation detection kit, gibson assemblycloning kit, in fusion hd cloning plus ce, monarch or genelute spin dna gel extraction kit, monarch or genelute spin plasmid miniprep kit, cathode buffer container, anode buffer container, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplc beh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfi hf, fastdigest acc65i, fastdigest maubi, 10x tris acetate boric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycine sulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2,4 dichlorophenoxyacetic acid, indole 3 acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade for lc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase , alcalase, phytic acid assay kit, trypsin activity assay kit, 2,2 diphenyl 1 picrylhydrazyl, meta phosphoric acid, amylose, l amino //bid details 2 / 130

Blood Bank Reagent Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government And Public Sector

Central Government/Public Sector

State Government

Central Government/Public Sector

Central Government/Public Sector

State Government