Web Analytics Made Easy - StatCounter

Bp Appratus Tenders

Get complete information related to latest Bp Appratus Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Bp Appratus Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Bp Appratus Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :42476610 Due date: 18 Nov, 202518 Nov, 2025 25.00 Lacs
Tender For supply of bead pro tubes 2ml 50 reaction,shredder 250 reaction,magnetic beads for nucleic acid purification 400 ml,dna cleanup kit for environmentalcomplex samples 50 reaction,twist universal adapter system truseq compatible 96 samples plate,ampure pb bead size selection kit,high molecular weight dna extraction kit 96 reaction,inhibitor removal kit 50 reaction,100 bp dna ladder ready to use 50 ugml 125 lanes,1 kb dna ladder 50 ugml 125 lanes,repair mix for ffpe 96 reaction,recombinant albumin molecular biology grade 12 mg,dna repair mix 150 reaction,gel and pcr clean up kit 250 reaction,whole genome amplification kit 50 reaction,multiple displacement amplification kit 100 reaction,exonuclease sap reagent 500 reaction,nucleic acid purification kit for sequencing 250 reaction,hot start dna polymerase 200 u,kits for hmw dna extraction from animal tissues 24 reactions,reagents to complete depletion size selection of dna 10 kb,reagents to complete depletion size selection of dna 25 kb

Central Government/Public Sector

CTN :42138962 Due date: 27 Oct, 202527 Oct, 2025 NA
Tender For corrigendum : supply of cryo unit , contrast bath , thera loops - five pairs of each different colour , physio ball , weight criff 0.5kg pair , weight criff 1kg pair , weight criff 2kg pair , iv stand , syringe pump , infusion pump , multi channel monitor , ambu bag-adult , ambu bag-infant , bp appratus , pulse oxymeter , stethoscope , electronic weighing scale , crash cart , hbv kit , hcv kit , lencofilters for prbc , fridge 220 ltr , table 6x3 , almirah 36x78x19 , wooden stool , plastic chair , kmc chair

CTN :42150380 Due date: 01 Nov, 202501 Nov, 2025 NA
Tender For corrigendum : supply of conditioning reagent 3500 series catalogue no. 4393718 , hi-di formamide, 5ml 4 tube catalogue no. 4440753 , bdt v3.1 rr-100 and seq buffer each catalogue no. 4337455 , bigdye xterminator kit 20 ml each catalogue no. 4376487 , exosap-it 500 reactions catalogue no. 78201.1 ml , anode buffer container 3500 series 4 pack catalogue no. 4393927 , cathode buffer container 3500 series 4 pack catalogue no. 4408256 , pop-7 polymer for 3500 series genetic analyzers 384 samples catalogue no. 4393708 , sequencing standards bigdye terminator v3.1 3500 series catalogue no. 4404312 , ds33 matrix standard g5 kit catalogue no. 4345833 , miniseq high output kit each having 300 cycles catalogue no. fc-420-1003 , nextera dna flex library prep each having 96 samples catalogue no. 20060059 , idt dna or rna ud indexes 96 samples catalogue no. 20091654 , high sensitivity d 1000 screen tape catalogue no. 5067-5584 , high sensitivity d 1000 reagent catalogue no. 5067-5585 , loading tips 10 pk catalogue no. 5067-5599 , qubit dsdna hs high sensitivity assay kit each having 500 assays catalogue no. q32854 , qubit tm assay tubes catalogue no. q32856 , vitek ms -ds target slides, ref code - 410893 biomerieux , vitek ms - chca matrix, ref code - 411071 biomerieux , vitek ms - silica orange gel, ref code - 411721 biomerieux , e.coli atcc 8739, ref code - 0483p biomerieux ) /bid number : gem/2025/b/6733087 * /dated: 04-10-2025 & & / bid document 1 / 21

CTN :42409946 Due date: 01 Nov, 202501 Nov, 2025 NA
Tender For supply of amplifier audio speaker with trolley,human body dummy,big oxygen stand,bull nose fitting,cervical collar,bp appratus,combat cloth

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

CTN :42240198 Due date: 31 Oct, 202531 Oct, 2025 NA
Tender For supply of consumables for wildlife studies dna extraction kit, multiplex pcr kit, and 96-well pcr plates and providing microsatellite fragment analysis and dna sequencing services at assam state zoo, guwahati

State Government

CTN :42250113 Due date: 01 Nov, 202501 Nov, 2025 93.00 Lacs
Tender For supply of sybr premix - tli rnas h plus , syringic acid , sinapic acid , sodium arsenate dibasic hydrate , 37 components fame mix , 2 3 5- tri phenyl tertazolium bromide , 2 4 6-tris 2-pyridyl- s-triazine , tannic acid , nnnn-tetramethyl ethylene diamine , vanilic acid , water sterile nuclease free , aflatoxin g1 , aflatoxin g2 , aflatoxin b1 , aflatoxin b2 , hemicellulase , alcalase , phytic acid assay kit , trypsin activity assay kit , 2 2-diphenyl-1-picrylhydrazyl , meta- phosphoric acid , amylose , l-amino acid assay kit , n- benzoyl-dl-arginine-p-nitroanilide bapa , trypsin - porcine pancreatic , methanol hplc grade , pancreatin , pepsin , potassium thiocyanate kscn , tannic acid standard , vanillin , tri chloro acetic acid , tris base , anthrone , hpp vessel gasket , hpp sensor probe , pectinase , cellulase , phytic acid assay kit , tannin microplate assay kit , saponin microplate assay kit , n benzoyl-dl-arginine p-nitroanilide hydrochloride , trypsin solution , phosphotungstic phophomolybdic acid , neutrase , orthophthaldehyde , 2- mercaptoethanol , l-glutathione , l-serine , ultra centrifugal filter 3 k da mwco , alpha glucosidase , ace inhibitory activity assay , indophenol dye , betacyanin , tuning and performance standards for lc ms , methyl myristate , linolenic acid methyl ester , amino acid kit , 3 5-dinitro salicylic acid reagent , p-nitrophenyl a-d-galactopyranoside , trypsin edta , acrylamide , n n-methylene bis-acrylamide , n n n n-tetramethylethylenediaamine , fluorometric , l- tyrosine , antimicrobial susceptibility test discs , mcfarland standard , phenol chloroform isoamyl alcohol , listeria monocytogenes detection kit , dna ladder 100 bp , glycine- sodium hydroxide buffer , potassium acetate , betanin , quercetin , kaempferol , 96-well polystyrene microtiter plate , indicaxanthin , 2 2-diphenyl-l-picrylhydrazyl , protein standards for electrophoresis , acarbose extrapure , tris acetate edta buffer , tris borate edta buffer , listeria monocytogenes atcc 700301 lyophilized culture , listeria monocytogenes atcc 700302 lyophilized culture , papaya mosaic virus elisa kit , papaya ringspot virus elisa kit , papaya leaf curl virus elisa kit , soybean mosaic virus elisa kit , urdbean crinkle virus elisa kit , mungbean yellow mosaic virus elisa kit , okra enation leaf curl elisa kit guide it mutation detection kit, gibson assemblycloning kit, in fusion hd cloning plus ce, monarch or genelute spin dna gel extraction kit, monarch or genelute spin plasmid miniprep kit, cathode buffer container, anode buffer container, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplc beh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfi hf, fastdigest acc65i, fastdigest maubi, 10x tris acetate boric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycine sulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2,4 dichlorophenoxyacetic acid, indole 3 acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade for lc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase , alcalase, phytic acid assay kit, trypsin activity assay kit, 2,2 diphenyl 1 picrylhydrazyl, meta phosphoric acid, amylose, l amino //bid details 2 / 130

Central Government/Public Sector

CTN :42194271 Due date: 29 Oct, 202529 Oct, 2025 NA
Tender For supply of custom oligo dna synthesis 25 nmole hpsf , bi-directional amplicon seq 50? l of amplicon dna @ 50ng/? l bi- directional single pass sequencing , gel extraction kit (250 rxn)
 Loading, Please wait...

Connect us via What's Up