Web Analytics Made Easy - StatCounter

Cefixime Oral Suspension Tenders

Get complete information related to latest Cefixime Oral Suspension Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Cefixime Oral Suspension Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Cefixime Oral Suspension Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :41676385 Due date: 07 Nov, 202507 Nov, 2025 97.00 Crore
Tender For corrigendum : supply of drugs under gropu no 4. - albendazole tablet ip 400 mg (chewable), 1x10, amikacin sulphate injection 100mg/2ml, 2 ml vial, amikacin sulphate injection 500mg/2ml, 2 ml vial, amoxicillin capsule 250 mg, 1x10, amoxicillin capsule 500 mg, 1x10, amoxicillin oral suspension 125 mg/5 ml, 60 ml bottle with measuring cap, azithromycin tablet 500 mg, 1x5/1x10, azithromycin oral suspension 200 mg/5ml , 15 ml bottle with measuring cap, azithromycin injection 1 gm, vial, amoxicillin (a) + clavulanic acid (b) powder for injection 1 g (a) + 200 mg (b), vial, amoxicillin (a) + clavulanic acid (b) tablet 500 mg (a) + 125 mg (b) , 1x6/1x10, amoxicillin (a) + clavulanic acid (b) oral liquid 200 mg (a) + 28.5 mg (b)/5 ml, 30 ml bottle with measuring cap, amoxicillin (a) + clavulanic acid (b) dry syrup 125 mg (a) + 31.25 (b)/5 ml, 30 ml bottle with measuring cap., ampicillin capsule 500 mg, 1x10, ampicillin powder for injection 500 mg , vial, cefixime tablet 200 mg, 1x10, cefixime oral suspension 100 mg/5 ml, 30 ml bottle with measuring cap, cefotaxime powder for injection 250 mg , vial, cefotaxime powder for injection 1 g, vial, ceftriaxone powder for injection 250 mg , vial, ceftriaxone powder for injection 1 g , vial, ceftriaxone (a) +sulbactum (b) injection (a) 1 gm + (b) 500 mg., vial, cefuroxime tablet 500 mg, 1x10, ciprofloxacin tablet 250 mg, 1x10, ciprofloxacin tablet 500 mg, 1x10, ciprofloxacin injection 200 mg/100 ml, 100 ml ffs bottle, co-trimoxazole [sulphamethoxazole (a) + trimethoprim (b)] tablet 800 mg (a) + 160 mg (b) , 1x10, co-trimoxazole [sulphamethoxazole (a) + trimethoprim (b)] oral suspension 200 mg (a) + 40 mg (b)/5 ml, 50 ml bottle with measuring cap, doxycycline capsule 100 mg, 1x10, doxycycline injection 100 mg, vial, gentamicin injection 10 mg/ml, 2 ml amp, gentamicin injection 40 mg/ml, 2 ml amp, ofloxacin tablet 200 mg, 1x10, linezolid tablet 600 mg, 1x10, linezolid injection 600 mg, 300 ml single dose container., meropenem injection 125 mg, vial, meropenem injection 1 gm , vial, nitrofurantoin tablet 100 mg, 1x10, piperacillin (a) + tazobactam (b) powder for injection 1 g (a) + 125 mg (b), vial, piperacillin (a) + tazobactam (b) powder for injection 4 g (a) + 500 mg (b), vial, vancomycin powder for injection 500 mg , vial, colistimethate sodium injection 1 million iu powder for solution, vial, faropenem tablet 200mg , 1x6, polymixin b injection 500000 iu, vial, tigecycline injection 50mg, vial, teicoplanin injection 400mg, vial, amphotericin b powder for injection 50 mg (lipid/ liposomal) , vial, clotrimazole pessary/vaginal tablet 100 mg, 1x6, fluconazole injection 200 mg /100 ml, 100 ml bottle, fluconazole tablet 150 mg, 1x1, itraconazole capsule 100 mg, 1x4, voriconazole tablet 200 mg , 1x4, acyclovir tablet 200 mg, 1x10, acyclovir powder for injection 250 mg , vial, valganciclovir tablet 450 mg, 1x2, entecavir tablet 0.5 mg, 1x30(bottle), ribavirin capsule 200 mg, 1x4, sofosbuvir tablet 400 mg, 1x28, tenofovir tablet 300 mg, 30 tablets in a container., metronidazole tablet 400 mg, 1x10, metronidazole injection 500 mg/100 ml , 100 ml ffs plastic bottle, metronidazole oral suspension 200 mg/5 ml, 60 ml bottle with measuring cap, norfloxacin(a) + tinidazole(b) tablet 400 mg(a) + 600 mg(b), 1x10, ofloxacin(a)+ornidazole(b) tablet (a)200 mg + (b)500 mg, 1x10, artemether (a) + lumefantrine (b) tablet 20 mg (a) + 120 mg (b) , 1x6, artemether (a) + lumefantrine (b) tablet 40 mg (a) + 240 mg (b) , 1x6, artemether (a) + lumefantrine (b) tablet 80 mg (a) + 480 mg (b) , 1x6, artemether (a) + lumefantrine (b) oral suspension 80 mg (a) + 480 mg (b)/5 ml, 30 ml bottle with measuring cap, artesunate powder for injection 60 mg , vial, artesunate powder for injection 120 mg, vial, chloroquine chloroquine phosphate tablet 250 mg equivalent to chloroquine 150 mg base. , 1x10, chloroquine oral suspension 50 mg/5 ml, 60 ml bottle with measuring cap, primaquine tablet 2.5 mg, 1x10, primaquine tablet 7.5 mg, 1x10

Central Government/Public Sector

CTN :41676387 Due date: 07 Nov, 202507 Nov, 2025 9.00 Crore
Tender For corrigendum : supply of drugs under group 3 - adrenaline injection 1 mg/ml, 1 ml amp, betamethasone injection 4 mg/ml, 1 ml amp, cetirizine syrup 5 mg/5 ml, 30 ml bottle with measuring cap, dexamethasone tablet 0.5 mg, 1x10, dexamethasone injection 4 mg/ml, 2 ml amp, fexofenadine tablet 180 mg, 1x10, hydrocortisone powder for injection 100 mg, vial, levocetirizine tablet 5 mg ip, 1x10, methylprednisolone injection 500 mg, vial, pheniramine injection 22.75 mg/ml, 2 ml amp, prednisolone tablet 10 mg, 1x10, prednisolone syrup 5 mg/5 ml , 60 ml bottle with measuring cap, calcium gluconate injection 100 mg/ml, 10 ml amp, n-acetylcysteine tablet 600 mg, 1x10, neostigmine injection 0.5 mg/ml, 1 ml amp, pralidoxime chloride (2-pam) injection 25 mg/ml, 20 ml amp/vial, snake venom antiserum injection(soluble/liquid polyvalent), 10 ml vial, snake venom antiserum powder for injection(lyophilized polyvalent), vial with 10 ml sterile water for injection for reconstitution

State Government

CTN :41811158 Due date: 10 Nov, 202510 Nov, 2025 NA
Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, atenolol(100mg),tablet, atorvastatin(40mg),tablet, atropine sulphate 1%(5 ml vial),eye drop, azithromycin 1gm + cefixime 400mg((1 + 1 tab)),tablet, aztreonam(1gm vial),injection, baclofen(40 mg tab),tablet, benzoyl peroxide 2.5% 20 gm(ointment/gel),tube, betamethasone dipropionate(0.05% (15gm) tube),ointment or cream, bicalutamide(50mg ),tablet, bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg/5ml syp(100 ml bottle),syrup, budesonide nebulising suspension containing budesonide(0.5 mg/2 ml, 2ml amp),respule, bupivacaine hydrochloride (not for spinal use) (0.5%)( 4ml amp/vial),vial, bupivacaine hydrochloride 0.25%(20 ml vial),injection, bupivacaine hydrochloride(0.5% (20 ml vial)),injection, calamine lotion((contains per 1000 ml:- calamine 150 gm,zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml bottle),lotion, calcitriol 0.25 mcg + calcium 500mg+ mecobalamin 1500mcg+ omega-3 acid ethyl esters-60 bp+ folic acid-400mcg + elemental boron 1.5mg(capsule/soft gelatin capsule),capsule, calcium carbonate(500 mg),tablet, calcium citrate - 1000mg (elemental ca equivalent to 250 mg and vitamin d3 400 iu)(-),tablet, calcium leucovorin(50 mg/vial inj),injection, calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental(calcium 500mg and cholecalciferol ip 250 iu),tablet, capecitabine(500mg),tablet, carboplatin(450mg 45ml multidose vial),injection, carboxymethyl cellulose 0.5% eye drop(5 ml),eye drop, carboxymethylcellulose sodium eye drop 0.5%(10ml),eye drop, carvedilol(3.125 mg),tablet, carvedilol(6.25 mg),tablet, cefixime oral suspension(100 mg / 5 ml (30 ml bottle)),suspension, cefixime(200 mg tab (dt tablet also acceptable) ),tablet, cefotaxime sodium(250 mg vial),injection, cefotaxime sodium(500 mg/vial),injection

Central Government/Public Sector

CTN :42211491 Due date: 03 Nov, 202503 Nov, 2025 NA
Tender For corrigendum : supply of chemical e e -macro tips 5ml , ammonium sulphate for plant tissue culture 500 gm , calcium chloride dihydrate for tissue culture 500 gm , sucrose for tissue culture 5 kg , sodium thiosulphate anhydrous extrapure ar 500 gm , agar tissue culture tested 500 gm , wide mouth bottle ldpe , wide mouth square bottle hdpe , jerrican hdpe , wash bottle new type , analytical long stem funnel pp , accupipet-starter kit , macro tips 5 ml , spinix- vortex shaker , spinwin mc-00 micro centrifuge , nitrile gloves powder free , kimwipes wipes , test tube cap pp , planton , staining box pp , biohazard bags pp , autoclavable bags pp , 5-sulphosalicylic acid dihydrate acs , tris buffer for hplc 99 9 , luria bertani broth , luria bertani agar , n-hexane pure 99 , agarose high eeo for molecular biology , citric acid anhydrous extrapure 99 , sodium bicarbonate extrapure, 99 , silica gel blue self indicating coarse 58 mesh , boric acid extrapure 99 5 , phytic acid sodium salt hydrate insp6 extrapure 70 , polyethylene glycol 6000 powder peg 6000 , isopropanol ipa for molecular biology 99 8 , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof a , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof b , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof c , custom dna oligos 25 nmol in tubes hpsf purification full yiedl lyophilized qc with ladi tof d , longamp taq dna polymerase 500 units , q5 high-fidelity dna polymerase - 100 units , ecori - 10000 units , bamhi - 10000 units , hind- iii-hf - 10000 units , bsai-hf v2 - 1000 units , primescrip 1st strand cdna synthesis kit , e coli dh5 competent cells , e coli dh5 competent cell , mighty cloning reagent set blunt end , mighty cloning reagent set blunt end s , water nuclease free , murashige skoog medium w o sucrose agar , hwso9 , hwg09 , salicyclic acid , indole-3-acetic acid iaa , 6-aminopurine vitamin b4 , gibberellic acid ga3 , jasmonic acid , ethephon , generuler 50 bp dna ladder ready-to-use 50 g , generuler 1 kb dna ladder 5 x 50 g , dntp set 100 mm solutions 4 x 1 ml , dreamtaq dna polymerase 500 u , 6x dna loading dye 5 x 1 ml , water nuclease-free 4 x 1 25 ml , water nuclease free 30 ml , phusion high-fidelity dna polymerase 100 u , 0 510 l universal fit gentip natural, bulk low retention non sterile , 100 1000 l universal fit gentip natural, bulk bevelled low retention non sterile , 0 2ml clear 96 well pcr plate no skirt high profile , sealing mat for 96 pcr plate white , storage rack for 1 5 2 0ml tubes assorted 100 well , autoclave bags 415 x 600mm , centrifuge tube with cap conical, sterile racked , 25 well pc rack , micro tube rack 1 5 ml , digital micro pipette , tips for gensleek-10000 clear , parafilm m sealing film , silicone lab mat , magbox , cube tube rack , adapt-a-rack , floating microtube rack , sample container , carboys with stopcock , 4-layer pp activated carbon lab mask , tough-tags , thermo-labserve soft blue nitrile gloves , thermo-labserve soft blue nitrile glove , kimberly-clark purple nitrile gloves-m , safeskin purple nitrile gloves-l , ethanol molecular biology grade , autoclavable bag , accupipette 1 5ml , moisture proof bottle with inner lid 1 litre , cuvettes disposable 4ml , test tube basket 160 160 160 mm , face mask , porcelain buchner funnel , ceramic heater quartz tube-4l , double distillation unit 2 5 lph with quartz heater , ceramic //bid details 2 / 61 heater_quartz tube 2 5 l accs , circulating water bath 12 ltr , magnetic stirrers heat stir , hot plate , glass dryer

CTN :42537505 Due date: 07 Nov, 202507 Nov, 2025 NA
Tender For supply of running contract for inj.lyophilized powder contains follitropin alfa recombinant dna follicle stimulating hormone 75 iu (5.5mcg) in vial packing.

CTN :42150370 Due date: 01 Nov, 202501 Nov, 2025 2.09 Lacs
Tender For corrigendum : supply of phytohemagglutinin m-form (pha-m) , lyophilized , dapi/antifade mounting solution 150 ng/ml , colcemid solution for cell culture (10ml/bottle) , tween 20 (500ml/bottle) , 20 x ssc molecular grade powder (bottle of 500 gms)

State Government

CTN :41782890 Due date: 03 Nov, 202503 Nov, 2025 NA
Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, ketamine hydrochloride(50mg/ml (10 ml vial)),injection, ketorolac eye drop 0.5%,(5ml),drop, ketorolac(10 mg tablet),tablet, labetalol(100 mg),tablet, l-asparaginase 5000 iu lyophilized(vial),injection, levocarnitine-(500mg),tablet, levocetirizine + monteleukast 2.5 mg + 4 mg / 5 ml(60 ml bottle,suspension),suspension, levosalbutamol 100 mcg + ipratropium bromide(40 mcg),powder for inhalation, levothyroxine(50 mcg),tablet, levothyroxine/thyroxine(100 mcg),tablet, lignocaine 2% + adrenaline 5 mcg/ml(30 ml ),injection, lignocaine hydrochloride(2% w/v (30 gm tube)),gel, linagliptin 2.5mg+metformin 500mg(tab),tablet, linezolid tab(600 mg),tablet, linezolid(200mg / 100ml ),infusion, liposomal amphotericin b(50 mg),injection, lorazepam(1 mg),tablet, losartan(25 mg),tablet, luliconazole(1% w/w),cream, mephentermine inj 30mg/ml(10 ml vial),injection, meropenem 250 mg / vial(250mg/vial),injection, methyl ergometrine inj meleate(0.2 mg /ml (1ml amp)),injection, methyl prednisolone sodium succinate inj.1000mg vial(1000mg vial),injection, methylcobalamine (vitamin b12) 500 mcg /ml 3 ml, metoprolol inj 1 mg/ml(5ml vial),injection, metronidazole 1%(15 gm tube),ointment, metronidazole oral suspension(200 mg/5ml (60 ml bottle)),suspension, metronidazole(0.75 % cream),tube, midazolam(1mg/ml (10ml vial)),injection, midazolam(1mg/ml (5ml amp)),injection

Central Government/Public Sector

CTN :42270203 Due date: 03 Nov, 202503 Nov, 2025 16.98 Lacs
Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

State Government

CTN :42250113 Due date: 01 Nov, 202501 Nov, 2025 93.00 Lacs
Tender For supply of sybr premix - tli rnas h plus , syringic acid , sinapic acid , sodium arsenate dibasic hydrate , 37 components fame mix , 2 3 5- tri phenyl tertazolium bromide , 2 4 6-tris 2-pyridyl- s-triazine , tannic acid , nnnn-tetramethyl ethylene diamine , vanilic acid , water sterile nuclease free , aflatoxin g1 , aflatoxin g2 , aflatoxin b1 , aflatoxin b2 , hemicellulase , alcalase , phytic acid assay kit , trypsin activity assay kit , 2 2-diphenyl-1-picrylhydrazyl , meta- phosphoric acid , amylose , l-amino acid assay kit , n- benzoyl-dl-arginine-p-nitroanilide bapa , trypsin - porcine pancreatic , methanol hplc grade , pancreatin , pepsin , potassium thiocyanate kscn , tannic acid standard , vanillin , tri chloro acetic acid , tris base , anthrone , hpp vessel gasket , hpp sensor probe , pectinase , cellulase , phytic acid assay kit , tannin microplate assay kit , saponin microplate assay kit , n benzoyl-dl-arginine p-nitroanilide hydrochloride , trypsin solution , phosphotungstic phophomolybdic acid , neutrase , orthophthaldehyde , 2- mercaptoethanol , l-glutathione , l-serine , ultra centrifugal filter 3 k da mwco , alpha glucosidase , ace inhibitory activity assay , indophenol dye , betacyanin , tuning and performance standards for lc ms , methyl myristate , linolenic acid methyl ester , amino acid kit , 3 5-dinitro salicylic acid reagent , p-nitrophenyl a-d-galactopyranoside , trypsin edta , acrylamide , n n-methylene bis-acrylamide , n n n n-tetramethylethylenediaamine , fluorometric , l- tyrosine , antimicrobial susceptibility test discs , mcfarland standard , phenol chloroform isoamyl alcohol , listeria monocytogenes detection kit , dna ladder 100 bp , glycine- sodium hydroxide buffer , potassium acetate , betanin , quercetin , kaempferol , 96-well polystyrene microtiter plate , indicaxanthin , 2 2-diphenyl-l-picrylhydrazyl , protein standards for electrophoresis , acarbose extrapure , tris acetate edta buffer , tris borate edta buffer , listeria monocytogenes atcc 700301 lyophilized culture , listeria monocytogenes atcc 700302 lyophilized culture , papaya mosaic virus elisa kit , papaya ringspot virus elisa kit , papaya leaf curl virus elisa kit , soybean mosaic virus elisa kit , urdbean crinkle virus elisa kit , mungbean yellow mosaic virus elisa kit , okra enation leaf curl elisa kit guide it mutation detection kit, gibson assemblycloning kit, in fusion hd cloning plus ce, monarch or genelute spin dna gel extraction kit, monarch or genelute spin plasmid miniprep kit, cathode buffer container, anode buffer container, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplc beh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfi hf, fastdigest acc65i, fastdigest maubi, 10x tris acetate boric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycine sulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2,4 dichlorophenoxyacetic acid, indole 3 acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade for lc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase , alcalase, phytic acid assay kit, trypsin activity assay kit, 2,2 diphenyl 1 picrylhydrazyl, meta phosphoric acid, amylose, l amino //bid details 2 / 130
 Loading, Please wait...

Connect us via What's Up