Web Analytics Made Easy - StatCounter

Ceramic Polyurethene Hydrocyclone Apex Tenders

Get complete information related to latest Ceramic Polyurethene Hydrocyclone Apex Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ceramic Polyurethene Hydrocyclone Apex Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ceramic Polyurethene Hydrocyclone Apex Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :40001106 Due date: 17 Apr, 202517 Apr, 2025 NA
Tender For procurement of 04 in number medicines and consumables at inhs patanjali - diethyl ether solvent bott of 500 ml , tab tenofovir 300 mg , levo salbutamol sulphate, 2.5 ml, containing 1.25 mg, respule , abiraterone acetate 250mg tab

CTN :39925929 Due date: 16 Apr, 202516 Apr, 2025 6.54 Lacs
Tender For supply of lab chemicals at sstps(o and m),suratgarh.-, 1-amino-2-naphthol-4- , , sulphonic acid (1 pkt = 25 gm) , , ammonium chloride (1 pkt =500gm) , , ammonium molybdate tetrahydrate (1 pkt=500 gm) , , ammonium perpurate (1 pkt=5gm) , , acetone (1pkt= 500 ml) , , ammonia solution 25% (1 pkt=2.5 itr) , , acetic acid (1pkt= 2.5 ltr) , , bromo cresol green 0.04% indicator ph 3.6-5.2 yellowish-green (1pkt= 125 ml) , , bleaching powder (1 pkt =500 gm) , , conc. hydrochloric acid (1 pkt=500ml) , , chlorotex reagent (1 pkt =100 ml) , , diethyl ether (01 pkt=500 ml) , , ethanol (1 pkt =500 ml), , , etylene diamine tetra acetic acid disodium salt dihydrate (1pkt= 500gm) , , eriochrome/solochrome black -t (1pkt= 25gm) , , glycerol anhydrous (1 pkt =2.5 ltr) , , 1 n hydrochloric acid ampule (1 pkt= 06 no's) , , hexamine (1 pkt = 500 gm) , , hydroxyl amine hydrochloride (01 pkt=500 gm) , , isopropyl alcohol (1pkt= 2.5ltr) , , n/10 lodine ampule (1 pkt = 06 nos.) , , lead nitrate (1 pkt = 500 gm) , , methanol (1 pkt =2.5 ltr) , , methyl red 0.01% indicator solution ph 4.3-6.3 red-yellow (1pkt= 125 ml) , , mercuric thio cyanate (1 pkt= 100gm) , , nessler reagent (1 pkt = 100 ml) , , nitric acid (1 pkt= 2.5 ltr) , , oxalic acid (1 pkt =500 gm) , , o-toludine (1pkt= 500gm) , , para dimethyl amino benzaldehyde (1 pkt =500 gm) , , potassium hydroxide pellets (1 pkt =500 gm) , , e , , pyrogallol (1 pkt =100 gm) , , 1,10 phenenthroline (1pkt=5gm) , , phenophthalein indicator (1 pkt =125 ml), , , ph indicator paper (ph 1.0-14.0) with colour scale , , sodium meta bisulphite (1 pkt =500 gm), , , sodium sulphite (1 pkt =500 gm), , , sulphuric acid (1 pkt =2.5 ltr) , , sodium acetate (1pkt= 500gm) , , sodium hydroxide pellets (1pkt= 500gm) , , starch soluble (1pkt=500gm) , , n/10 sodium thio sulphate ampule , , silicone high vaccum grease (lab) (1pkt= 50 gm) , , 1 n sodium hydroxide ampule (1 pkt = 06 nos.) , , sodium potassium tartarate (1pkt=500gm) , , silver nitrate (01 pkt=100 gm) , , standard silica (1000 ppm) (1 pkt=500 ml) , , toluene (1pkt= 2.5 ltr) , , universal indicator ph 4-11 indicator with colour chart (1 pkt =500 ml), , , xylene (sulphur free) (1 pkt= 2.5ltr) , , xylenol orange indicator(01 , , pkt=10 gm) ,

State Government

CTN :39967336 Due date: 06 May, 202506 May, 2025 387
Tender For supply of chemicals and glass wares to the mmc and ri and its associated hospitals. - cefuroxime 30mg 5x100discs, ceftriaxone 30mg 5x100discs, cefoxitin 30mg 5x100discs, cefotaxime 30mg 5x100discs, cefazolin 30 mg 5x100 discs, cefepime 30mg 5x100discs, aztreonam 30mg 5x100discs, azithromycin 15mg 5x100discs, amoxicillin-clavulanic acid 20/10mg5x100discs, ampicilin sulbactam, ampicilin 10mg 5x100discs, amikacin 30mg 5x100discs, meropenem vaborbactam 20/10mg 5x100discs, imipenem relebactam 10/25 mg 5x100discs, moxiflaxacin 5mg 5x100discs, minocyclin 30mg 5x100discs, meropenem 10mg 5x100discs, imipenem 10mg 5x100discs, levoflaxacin 5mg 5x100discs, linezolid 30mg 5x100discs, high level gentamicin 120mg 5x100discs, lefamulin 20mg 5x100discs, gentamicin 10mg 5x100discs, fosfomycin 200mg 5x100discs, erythromycin 15mg 5x100discs, ertapenem 10mg 5x100discs, doxycycline 30mg 5x100discs, colistin (pure drug) 10mg 5x100discs, tedizolid 30mg 5x100discs, ceftarolin 30mg 5x100discs, ceftazidime-avibactum 30/20mg 5x100discs, cefiderocol 30mg 5x100discs, co-trimoxazole 1.25/23.75mg 5x100discs, ceftazidime 30mg 5x100discs, clindamycin 2mg 5x100discs, cipro flaxacin 5mg 5x100discs, cefotetan 30mg 5x100discs, brewel thioglycholate medium 500gm, peptone (bacteriological) 500gm, agarpowder(bacteriological) 500gm, macconkeyagar 500gm, mueller hinton agar 500gm, nutrientagar 500gm, disodium edta 125ml, cefatazidime clavulonate 30.oct 100discs/box, tobramycin 10mg 100discs/box, cefotetan 30mg 100discs/box, rifampicin (rif) 15mg 5x100discs, colistir e strips 0.016-256 mg/ml 10x100strips, vancomyan e strips 0.016-256 mg/ml 10x100strips, ceftotomane-tazobactam 30/10mg 5x100discs, imipcnem-relebactam 10/25mg 5x100discs, plazomicin 30mg 5x100discs, vancomycin 30mg 5x100discs, cefpodoxime 10 mg 5x100discs, tetracyclin 30mg 5x100discs, stretomycin 300 gm 5x100discs, sulbactam durlobactam 10/10 mg 5x100discs, piperacillin tazobactum 100/10mg 5x100discs, pencilin 10mg 5x100discs, nitrofurantoin 300mg 5x100discs, ceftolozane tazobactum 30/10 mg 5x100discs, cary blair medium 100gm, sodium deoxycholate 100gm, sodium taurocholate 500gm, tetrathionate broth base 100gm, tcbs 500gm, bird seed agar 100gm, deoxycholate citrate agar 100gm, moeller decorboxylase broth (ornithine) 250gm, moeller decorboxylase broth (lysine) 250gm, moeller decorboxylase broth (arginine) 250gm, lysine iron agar 250gm, bismuth sulphate agr 500gm, wilson and blair agar base 500gm, corn meal agar 500gm, bile esculin agar 500gm, dnase agar base 100gm, cled with bromothymol blue indicator 500gm, xylose lysine deoxycholate agar 500gm, tripticase soya broth 500gm, r2a agar 500gm, simon citrate agar base 500gm, christensen urea agar base 500gm, triple sugar iron agar 500gm, beef extract 500gm, brain heart infussionbroth (bhi) 500gm, sucrose 500gm, mannitol 25gm, actidione (cycloximide) 10gm, tetramethyl 4 phenylene iaminedihydrochloride 100gm, amylal cohol (isoamylalcohol) 1000ml, dimethyl aminobenzaldehyde pure (paradimethyl) 100ml, indole reagent 500ml, pottasium iodide 500gm, pottasium hydroxide 100gm 500gm, basicfucshin powder 500gm, phosphate powder 100gm, alberts stain (a&b) 125mleach, methylene blue 500ml, grams iodine 5gm 125ml, diethyl ether 500ml, zinc sulphate 25gm, lead acetate 25gm, glucose 500gm, lactose 500gm, raffinose 25gm, dulcitol 25gm, maltose 100gm, sorbitol 500gm, arabinose 25gm, mannose 500gm, glacial acitic acid 500ml , andrades indicator 500ml , robertsons cooked meat medium 500gm , sabouraud dextrose agar 500gm , mannitol salt agar 500gm , sodium chloride 500gm , inoculation loops with holder (change able loop) 1x24no/pack, metal loop holder 1x24no/pack, force psplain pointed 10inch, test tubes with rim 15x150mm, test tubes with rim 15x125mm, test tubes with rim 12x100mm, beakers 500ml 100ml, beakers 250ml, lense cleaning paper 10pkts/box, teasing needles 72pcs, cryo vials 2ml, autoclavable plastic petridishes 90mm, mac cartney (bhi bottles) 25 mlof 36 bottle/ pack, du

CTN :39858766 Due date: 18 Apr, 202518 Apr, 2025 NA
Tender For supply of lanthanum chloride , ammonium sulphamate , iodine resublimed , potassium carbonate , napthanol ar , methanesulfonic acid s , phthalein purple , methylene blue , orthophosphoric acid , mercuric iodide red , tin chloride dihydrate , bovin albumin , formic acid , formaldehyde solution , methanol hplc , diethyl ether

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39792980 Due date: 14 Apr, 202514 Apr, 2025 NA
Tender For price agreement of medicines drugs lab items and surgical items for a period of one year - procurement, diethyl ether solvent bott of 500 ml, lignocaine hcl 2 percent (without adrenaline) 30ml inj (suitable for ophthalmic use also), lignocaine hcl 2 perecent with adrenaline (1:80000) 30ml inj, diclofenac 75 mg/ml, 1 ml amp inj, lignocaine 100mg& ethanol 28mg/ml v/v spray container of 500/800ml, lignocaine hcl jelly 2percent tube of 30 gm with sterile tube and short nozzle suitable for intra uretheral use, should be packed within a sterile blister pack, atropine sulphate 0.6mg, 1 ml inj, midazolam 5 mg, 1 ml inj, paracetamol 650 mg tab, aceclofenac 100 mg, paracetamol 500 mg tab, paracetamol 325 mg + diclofenac sodium 50 mg tab, diclofenac sodium sr 100 mg tab, paracetamol with cysteine hcl monohydrate infusion 1000 mg/100 ml, common cold tab (cetirizine 5-10 mg + paracetamol 500 mg + pseudoephedrine 30-60 mg), deflazacort 6 mg, tab, diclofenac sodium 50 mg, enteric coated tab, diclofenac 25mg/ml ip, 3ml inj, ibuprofen 200 mg tab, ibuprofen syrup 100mg/5ml bott of 50 ml, ibuprofen 400mg tab, paracetamol 10 mg/ml infusion in 100 ml bottle, diclofenac diethylamine 2.32% w/v, quick penetrating topical solution-30 ml bottle, with metered dose spray, naproxen 250mg tab, paracetamol 500mg tab, paracetamol 150mg/ml, 2 ml iv, inj, paracetamol syp 125mg/5ml bott of 60 ml, paracetamol 325mg and ibuprofen 400mg tab, etoricoxib 120 mg tab, piroxicam 20 mg tab, piroxicam 40mg, 2ml inj, morphine 15mg, 1 ml inj, indomethacin 75 mg sr tab, allopurinol 100 mg tab, indomethacin 25mg tab/cap, ketorolac10mg tab, tramadol hcl 50 mg cap/tab, tramadol hc 50 mg/ml inj, aceclofenac 100 mg tab, febuxostat 40 mg tab, adrenaline tartrate (1:1000), 1 ml inj, cetrizine-dihydrochloride 10 mg tab, levo-cetrizine 5mg tab, cyproheptadine 4 mg tab, fexofenadine 30mg/5ml in 60ml bottle, montelukast 10mg + levocetrizine 5mg tab, promethazine syp 5mg/5ml bott of 60 ml, dexamethasone 0.5 mg tab, dexamethasone sodium phosphate 4.4 mg (equivalent to dexamethasone phosphate 4 inj, pregabalin 75 mg + methylcobalamine 1500 mcg tab, hydrocortisone sodium succininate 100 mg inj, pheniramine maleate inj 22.75 mg per ml amp of 2 ml, nor adrenaline bitartrate 2 mg/ml, 2 ml inj, pheniramine maleate 25 mg tab, prednisolone 5 mg tab, promethazine hcl 2.5percent, 25mgm/ml, 2 ml inj, pralidoxime 500mg/20ml inj, n-acetyl cysteine 200 mg/ml, 5 ml ampoule, divalproate sodium 500 mg, tab, pregabaline 75mg cap, levetiracetam 500 mg tab, oxcarbazepine 150 mg tab, oxcarbazepine 300 mg tab, carbamazepine 200 mg tab, carbamazepine 200 mg cr tab, carbamazepine syp 100mg/5ml bottle of 100 ml, clobazam 5 mg tab, clonazepam 2 mg tab, lorazepam 2mg/ml, 2ml inj, diazepam 10 mg, 2 ml inj, donepezil 5 mg tab, diazepam syp 2 mg/5 ml bottle of 60 ml, diazepam 5 mg tab, gabapentin 300 mg cap, phenytoin oral suspension containing phenytoin 100mg/4ml bottle of 100 ml, phenytoin sodium 100 mg tab, sodium valproate oral solution 200mg/5ml bott of 100 ml, sodium valproate 200 mg tab, lamotrigine 25 mg tab, sumatriptan 50 mg tab, sumatriptan nasal spray 20 mg, 10 metered doses, topiramate 25 mg tab, rizatriptan 5 mg tab, baclofen 10 mg tab, budesonide 200mcg inhaler, budesonide 200 mcg + formeterol 6 mcg autohaler, budesunide 1 mg respules, canagliflozin 100 mg tab, carbimazole 20 mg tab, chlorzoxazone 500 mg + diclofenac sodium 50 mg + paracetamol 325 mg tab, salmeterol 25 mcg + fluticasone 250 mcg autohaler, diacerin 50 mg tab, doxophyllin 400 mg tab, mesalazine 500mg tab, albendazole 400 mg tab, albendazole syp each 5 ml containing 200 mg bott of 10 ml syp, sitagliptin 50 mg + metformin 500 mg tab, ivermectin 6mg tab, amoxycillin ip 500 mg cap, spacer device for inhaler, pyrantel pamoate 250 mg/5ml susp., diethylcarbamazine 50mg tab, amitriptylline 25 mg tab, itopride 50mg tab, rifampicin 450mg + isoniazed 300mg combination cap/tab, rifampicin 600 mg+tab inh 300mg tab, ethambutol 200 mg tab, isoniaz
 Loading, Please wait...

Connect us via What's Up