Latest chemical reagents Tenders | Government chemical reagents Tenders

CTN :42001219

29 Oct, 2025 NA

Kolkata - West Bengal

Tender For corrigendum : different types of laboratory diagnostics reagents and kits for pathology department

CTN :42074790

18 Oct, 2025 NA

Datia - Madhya Pradesh

Tender For purchase of chemical, reagents, culture media and consumables in government medical college datia m.p. - chemical / reagents / media / consumables:, 1% l-arginire, 1% l-lysine, 1% l-ornithine, 1% l-ornithine, 1-naphthol (grm 1392), acetic anhydride, acetoacetate, acetone, acetone [ch3]2 co, acid fast staining kit, acrylic sheet, acrylic sheet cutter, albert stain kit (k-002), alcoholic naoh, alkaline peptone water (m618), alpha naphthol, amikacin 30 g, ammonium hydroxide, ammonium molybdate, ammonium oxalate (500ml), ammonium sulphate, amoxicillin clavulanic acid 20+10 g, amphotericin b, ampicillin, ampicillin/sulbactam 10/10mcg, anaerogas pack (le002a-05no), andrade peptone water (m885), arabinose (grm483), azithromycin 15mcg, aztreonam 30 mcg, bacitracin -10u/disc, bacteriological loop (4mm diameter calibrated to 0.01 ml), bacteriology stright wire, baritt reagent a, baritt reagent b, benedict s reagent ( 05 liter), benzene, bhi [broth] brain heart infusion, bhi broth (m210), bile pigment(bilirubin), bile salts mixture (rm-009), black genral waste polybags 40 kg bag, blood agar base [infusion base], bmw ploybags capacity 40 kg ( blue/red/yellow/black), bovine albumin, cary blair medium base (m202), caspofungin, cefazolin, cefepime 30 mcg, cefotaxime 30mcg, cefotaxime clavunic acid 30/10mcg, cefoxitin 30 mcg, ceftazidime 30mcg, ceftazidime clavulanic, ceftriaxone, cefuroxime 30 mcg, cellobiose (gm098), chrom agar candida, ciprofloxacin 5 g, clarythromycin 15mcg, cled agar with bromothymol blue, clindamycin 2mcg, coplin jar, copper sulphate, corbol fuchin powder, cornmeal agar (m146), cotrimoxazole, cotton roll, creatinine, creatinine reagent, crystal voilet, cysteine lactose electrolyte deficient agar (sm-792), deoxycholate citrate agar (m065), diacetylmonoxime, doxycycline 30mcg, dpx mount, dropper, dropping bottle cap, dulcitol (rm100), durhams tube, ehrlich s reagent, eosin stain, erythromycin 15mcg, ethanol 95%, ethenol alcohols (2.5 kg each), ether, filter paper whatsman no. 1, fluconazole, flucytosine, forceps (large), forceps (medium), formalin, fouchet s reagent (500 ml), gelatin agar (m290), gelatin agar (m920), gentamicin 10 g, glacial acetic acid (500 ml), glass cover slip, glass marking pencil white, glass slide, glucose kit, gluocse (250 gm), glycerin, gram negative broth (mm242), gram stain kit, grams iodine, green genral waste polybags 40 kg bag, haematoxylin stain, hand sanitizer, heavy silicone gloves, hydrochloric acid (dilute.), hydrogen peroxide, imipenem 10 g, immersion oil, indian ink, indole nitrate medium (m364), inmelin (grm103), inositol (grm102), iodine powder, ketoconazole, kovacs reagent (r008), l- moulds, lab grade ethanol, lamp batti, l-arginine (tc052), levofloxacin 5 g, linezolid 30mcg, liqour ammonia (500 ml), liquid handwash(co148), liquor ammonia, long sturdy heavy duty gum boots, lugols iodine, maccartny bottle 100 ml, macconkey agar, magnesium chloride, magnesium sulphate, mannitol salt agar base, matchbox, measuring glass cylinder 1000ml, measuring glass cylinder 250ml, measuring glass cylinder 500ml, measuring glass cylinder 50ml, mercuric sulphate, meropenem 30mcg, metaphosphric acid, methanol, methyl alcohol, methyl red reagent, methylene blue, micropipet tips 1 ml, micropipet tips small (10-100 micro ltr), moller s decarboxylase base, motility agar (mannitol motility agar), mounting jar with cover (different size), moxifloxacin, mr vp broth, mueller hinton agar, nacl, netilmycin, nigrosin, nitrate broth, nitrate reagent a, nitrate reagent b, nitric acid, nitrofurantoin, norfloxacin 10mcg, novobiocin 05mcg, nutrient agar, nystatin, of basal medium (m395), of media, onpg disc, optochin 5mcg, oxbile or bile salt, oxidase disk, oxidase reagent, p. dimethylaminobenzaldehyde, paraffin wax, partition, penicillin g, petri plate glass 150mm, petri plate glass 75mm, petri plate glass 90x15mm, ph 4, ph 7 megilay instrument capsule, ph papers range 2-7, ph papers range 7-14, phenol, phenol red b

CTN :41897678

17 Oct, 2025 60.51 Lacs

Shimoga - Karnataka

Tender For supply of kfd rt-pcr reagents for virus diagnostic laboratory shimoga - beta actin qsy probe vic5tcaagatcattgctcctcctgagcgc3 50000picomoles, actin rp5gccgatccacacggagtact3 80000picomoles, actin fp5ggcacccagcacaatgaag3 80000picomoles, taqman fast virus 1 step master mix for qpcr catalog number 4444434 1 qty 200x5, taqman qsy probe-50nm kfdv ns5 probe 6fam atg gag agg agc gcc tga ccc g 22 bases catalog no 4482779 50000 picomoles, kfdv ns5 r1-tca tcc cca ctg acc agc at 20 bases catalog no 4304971 80000 picomoles, sequence detetction primer kfdv ns5f1 tgg aag cct ggc tga aag ag 20 bases 4304971 80000 picomoles

CTN :41819161

11 Oct, 2025 29.77 Lacs

Shimoga - Karnataka

Tender For kfd rt-pct testing rna kits and consumables for virus diagnostic lanoratory shimoga for fy-2025-26 - rna extraction manual kit pack of 250 rxn for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96, 24 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96 96 well for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,24 well well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,96 well to be filled with reagents for vdl laboratory, small safe skin purple nitrile gloves 12inch extended cuff pack of 50 aql 1.5 astm 6319 standard gauge thickness measurements mm mil middle finger .15 5.9,palm .12 4.7, cuff.09 3.5 pack of 50 for vdl laboratory, cryo box 100 places paper for vdl laboratory, digital thermometer ilr for vdl laboratory, digital thermometer deep freezer-20 for vdl laboratory, amber color screw capped eppendorf tubes 2ml pack of 500 for vdl laboratory, te 1x buffer ph 8.0 rnase free 500ml for vdl laboratory, kim wipes lint free tissue white colour 4.4 inch x 8.4 inch 280 sheets is 1 unit for vdl laboratory, ice packs gel 20gms pack for vdl laboratory, filter tips racked low retention autoclavable with aerosal filter,universal size compatible with all micropipettes, free of detectable dnase,rnase,human dna pcr,hydrophobic polyethylene filters 10ul pack of 96 x10 box for vdl laboratory, cryochill external thread vial self standing sterile 1.8 ml pack of 1000 for vdl laboratory, permanent autoclave-resistant labels for vdl laboratory, buoffant caps- head cap(pack of 100) for vdl laboratory, ziplocks covers 5x7 in kg for vdl laboratory, ziplocks covers 8x10 in kg for vdl laboratory, cutter (paper knife) for vdl laboratory, dust pan for vdl laboratory, three bucket mopping for vdl laboratory, wet mop for vdl laboratory, dry dust control mop for vdl laboratory, hypoclorite solution5% 5ltr for vdl laboratory, disinfectctant cleaner (lyzol type)5ltr for vdl laboratory

Central Government/Public Sector

CTN :41489566

13 Oct, 2025 1.00 Crore

Noida - Uttar Pradesh

Tender For corrigendum : open tender document for e-procurement of laboratory equipment (soil, aggregates, cement, reinforcing bar, concrete test equipment, water, geo-textile and geogrid) for material testing laboratory of iahe - soil, unconfined compressive strengthcompression device with digital load frame: hydraulic proving ring, dial gauge vernier callipers, timer, oven, weighing balance, shear strength vane shear apparatus, grain size analysis as per is:2720 (part- iv)pipette apparatus (i) sampling pipette (ii) glass sedimentation tubes (iii) weighing bottles (iv) deleted (v) stirring apparatus (vi) sieves -2mm, 425umm , 75umm is sieves (vii) deleted, specific gravityhydrometer apparatus: two 1000 ml graduated cylinders, dispersing agent solution containing sodiumhexa-metaphosphate, dessicator and centimetre scale., shrinkage limit testfull set of equipments 1.) evaporating dish of porcelain, 2.) spatula and straight edge, 3.) balance-sensitive to 0.01 g minimum.4.) shrinkage dish. circular, porcelain or non-corroding metal dish, 5.) glass cup. 50-55 mm in diameter and 25 mm in height,6.) glass plates. two, 75x75 mm one plate of plain glass and the other prongs, 7.) thermostatically controlled oven,8.) wash bottle containing distilled water, 9.) graduate-glass, with capacity of 25 ml. 10.) mercury., sand equivalent value(i) graduated cylinder (ii) irrigator tube (iii) siphon assembly (iv) weighted foot assembly (v) measuring can (vi) sieve -4.75mm (vii) funnel (viii) 4- litre bottle (ix) flat pan (x) timing device (xi) sand equivalent shaker, ph test -electronic method(i) ph meter (ii) digital balance 300 gm capacity-sensitive 0.001gm (iii) 100ml glass beaker -3nos. (iv) volumetric flask-500ml -nos. (v) wash bottle-100 ml (vi) mortar with rubber covered pestle, aggregates, polished stone value (i) accelerated polish machine mounted on firm ,level and non resilient base of stone or concrete (ii) road wheel (iii) means for rotating road wheel (iv) means for bringing the surface of a rubber-tyred wheel of 20 cm diameter and 5 cm breadth to bear on the stone surface of the road wheel with a total load of 40 kg. (v) means to feed the sand and water at a uniform rate (vi ) means to feed the emery powder and water at uniform rate (vii) friction tester: is: 2386 part 4 as per specification of rrl uk (viii) 25 kg hard siliceous sand (ix) emery powder 5 kg, alkali aggregate reactivitymortar bar method: scales, weights, sieves, glass graduates, specimen moulds, mixing bowl, tamper, trowel, containers, length comparator, alkali aggregate reactivity chemical method:1. electronic balance2. pulveriser3. reaction container, reagents, glassware, petrographic examination 1. geological hammer2. petrographic microscope3. screen confirming to is sieve4. digital balance5. portable handheld cutting machine6. hand lens7. glass sides etc., deleterious material & organic impuritiessedimentation pipette: a watertight screw-topped glass jar, 1000 ml measuring cylinder, chemicals, containers, sieves, cement, soundness (autoclave apparatus)graduated glass cylinders, moulds, autoclave, length comparator, compaction (mortar cube vibrator), fineness (blaine air permeability apparatus), ph meter ( 2 in nos.), reinforcing bar (steel), reinforcing bar (steel) universal testing machine,to determine unit weight, yield strength,, proof stress, ultimate tensile strength, % elongation, bend and re-bend test, concrete test equipment, vibrating table 1mx1m(full set of equipments), needle vibrator ( 2 in nos.), permeability, dry shrinkage (shrinkage apparatus) ( 2 in nos.)(full set of equipments), air content (air entrainment meter apparatus)(full set of equipments), durability (rapid chloride ion permissibility apparatus), depth of penetration (water permeability apparatus) ( 2 in nos.)(full set of equipments), water, physical analysis of water, geo textile and geogrid, pull-out resistance of geotextile /geogrid

State Government

CTN :42078510

17 Oct, 2025 NA

Gandhinagar - Gujarat

Tender For rate contract for supply of various laboratory consumables - chemicals, plastic wares, glassware’s, certified reference materials (crms), reagents, refilling of various gases

CTN :42090782

06 Oct, 2025 NA

Port Blair - Andaman And Nicobar Islands

Tender For supply of laboratory reagents and consumables items for directorate of health services

CTN :42061046

30 Sep, 2025 NA

Daman - Gujarat

Tender For quotation for urgently required laboratory reagents at govt. hospital daman."

CTN :42061048

30 Sep, 2025 NA

Daman - Gujarat

Tender For quotation for urgently required laboratory reagents at govt. hospital daman."

Central Government/Public Sector

CTN :41830847

03 Oct, 2025 NA

Jamnagar - Gujarat

Tender For corrigendum : providing of selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of products/material - laboratory reagents; buyer to use custom filter to input technical specification of the product/material so that service provider may provide price offering accordingly; test; d-dimer,selection of laboratories for testing of pro

Chemical Reagents Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector