Web Analytics Made Easy - StatCounter

Cobalt Pellet Tenders

Get complete information related to latest Cobalt Pellet Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Cobalt Pellet Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Cobalt Pellet Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :40033398 Due date: 08 May, 202508 May, 2025 NA
Tender For supply of media chemicals and antibiotics for dept of micro biology at aiims bhopal - rare disease medicine, aesculin, agar agar powder, bacterioides bile esculin agar base, bird seed agar, blood agar base no.2, bovine serum albumin (bsa), brain heart infusion agar base, brain heart infusion broth base dehydrated, brucella agar base with hemin & vitamin k1, canavanine glycine bromothymol blue agar/cryptococcus differential agar dehydrated, chrom agar for isolation and identification of candida species., citrate agar, simmons, cled agar dehydrated, corn meal agar dehydrated, crome agar cromogenic group b streptococcus selective agar base, czapekdox agar dehydrated, dermatophyte test medium agar base dehydrated, dichloran rose bengal chloramphenicol yeast extract sucrose agar dehydrated, egg yolk agar base, hichrom agar m1297a, indole nitrate broth base, macconkey agar w/o cv, macconkey broth double strength dehydrated, malt extract agar dehydrated (meat), mannitol salt agar dehydrated, manniton motility test medium, moeller decarboxylase broth base, mueller hinton agar dehydrated, mueller hinton broth, cation adjusted, nitrate broth dehydrated, nutrient agar, oatmeal agar, potato dextose agar, propionibacter isolation agar, pyr agar, robertson cooked meat medium rcm, rpmi 1640 with glutamine & without sodium bicarbonate, w/o phenol red, sabourauds dextrose agar/sabourauds dextrose agar emmons modification dehydrated, sabourauds dextrose broth dehydrated, selenite f broth, sheep blood, sucrose powder, todd hewitt broth, tri sodium citrate, trihalose powder, triple sugar iron agar (tsi) dehydrated, tryptone soya agar, tryptone type 1, urea 40% supplement, yeast extract powder, yeast one broth (10x11ml), -naphthylamine readymade solution, acetic acid aldehyde free (acetone), acetone, agarose powder (molecular grade), aluminium ammonium sulfate, ammonia solution, andrades indicattor (1001), anerobic catalyst low tempreture (a00010 x 5), antisera for salmonella vi, aqueous solution of picric acid (saturated), autoclave indicator tape steam, b. fragilis atcc 25285, bacteroides selective supplement fd062-5vl, basic fuchsin, biological indicator for autoclave (la926-1x50no) geobacillus stearothermophilus scbis", biological indicatore hot air oven bacills atrophascus, bromothymol blue, buffer capsule ph 4.0, buffer capsule ph 7.0, buffer capsule ph 9.2, calcium chloride anhydrous, calcofluor white (liquid stain ready to use approx 100 ml), capreomycin sulfate cat. sigma c4142, carbol fuchsin, cc selective supplement fd010-5vl, citric acid, coagulase plasma, crystal violet, d- (+) glucose anhydrous, d-(-)-salicin, d-mannitol (mannitol sugar disc), demineralized water, di-potassium hydrogen phosphate anhydrous, diethyl ether ar grade, dmaca reagent (pyr reagent), dmso, dna ladder (100bp), dpx mountant, dulcitol sugar disk, egg yolk infusion, ethanol absolute (analytical grade), ferric ammonium sulphate, formaldehyde (40%), formalin solution, galactose sugar disk, galactose sugar powder, gas pack le0028-5no (anaero gas pack) 5x1nos, gelatin, giemsa powder, glacial acetic acid, glassware cleaning reagent, glucose sugar disk, glycerol (anhydrous emplura), hand rub / sanitizer, hand wash liquid soap, hematoxylin powder, hydrochloric acid (conc.), hydrogen peroxide 30% h2o2, hypochlorite (5%) / sodium hypochlorite 5%, immersion oil, india ink/nigrosine, inositol sugar disk, iodine crystals, iodine gram stain (gram iodine), kovacs indole reagent (indole : p-dimethyl benzaldehyde), l- arginine, l- ornithine hcl broth m688, l+ arabinose, lactophenol cotton blue (approx 100 ml) ready to use, lactose sugar, lycine hcl broth, lysol, magnesium sulphate anhydrous, malachite green, maltose, mannitol sugar powder, mcfarland standard set, methanol purified ar grade (hi-lr), methylene blue, modified zn stain, n-acetyl-l-cysteine, neutral red dye (indicator), neutral red powder, normal saline plain, nuclease free water, oleic acid, paraffin sterile

Central Government/Public Sector

CTN :40025038 Due date: 07 May, 202507 May, 2025 4.20 Lacs
Tender For supply of lab equipment - charts , models , slide permanent , specimens , pictures posters charts , beaker , dropping bottle , forceps , funnel , micro viewers , microscope , petri dish , pipette , skeleton , test tube holders , test tube stand , watch glass , water bath , wash bottle , burette , capillary tube , thermometer , ammonium solution , chromatography paper , formaldehyde , glycerine , robert solution , micro cover slip , micro glass slides , millions reagent , needle , nitric acid , sucrose , test tube ordinary , ph paper , blade for section cutting , acetic acid , brushes , blow pipe , burette stand , test tube brush , cork borer , cork presser , crucible tongs , charcoal slab borer , crucible , deflagrating spoon , distilation apparatus , drying cones , funnel stand or filter stand , pestle and mortar , pinch cock , retort stand , round file , sand bath , spirit lamp , test tube stand , test tube holder , triangular stand , tripod stand , trough , wire gauze , triangular clay pipes , beehie sheft , burettle , china dish , conical flasks , dessicator , gas jar dises , flasks , gas jar or cylinder , glazed tile , measuring flasks , retort , thistle funnel , woulfes apparatus , watch glass , ammonium carbonate , ammonium chloride , ammonium sulfate , ammonium bromide , aluminum sulfate , iron sticks , potassium nitrite , ammonium oxalate , sodium thiosulphate , zinc sulfate , cobalt nitrate , sodium hydroxide , copper sulfate , potassium nitrate , oxalic acid , magnesium sulfate , magnesium chloride , ammonium phosphate , sodium chloride , potassium ferrocyanide k4fe cn 6 , ferrous sulfate , sodium bromide , ammonium ferrous sulfate , potassium dichromate , barium chloride , strontium nitrate , sodium sulphide , potassium chromate , lead acetate , sodium sulfate , potassium iodide , lead nitrate , cedric ammonium nitrate , 2,4 dnp , universal indicator , ammonia solution nh4oh , phenol , aniline , bromine water , acetaldehyde , fehling solution a b , acetone , carbon disulfide , phenolphthalein , nesslers reagent , ammoniumm olybdate , nickel carbonate , nickel sulfate , manganese chloride , calcium chloride , sodium bisulphate. , cobalt acetate , chloroform , magnesium ribbon , zinc granual , lead nitrate pb no3 2 , potassium iodide ki , lead metal pb , ethyl acetate , sodium metal , pottasium permanganet kmno4 , pottasium dichromate k2cr2o7 , hydro chloric acid hcl , sulphuric acid h2so4 , nitric acid hno3 , ethanol , test tube , test tube holder , dropper glass , filter paper , glass rod , sodium sulfite , picric acid , borax , cobalt glass , aluminum metal , spatula , laboratory thermometer , drawing board , friction apparatus complete set with weight box , parallelogram apparatus , helical spring apparatus with weights , resonance apparatus , spherometer , screw gauge , wooden scale , stopwatch , sonometer set , sprit level , vernier calliper , beakers , connecting wires , concave mirror , convex mirror , convex lens , concave lens , glass slab , pendulum bob , cork rubber , hanger weights , metalic bob , slinky spring , spring balance , copper calorimeter , wave pendulum , barometer tube , lactometer , proof plane , boyles law apparatus , fortnis barometer , metallic cylinders brass , metal sphere , youngs modulus apparatus , hydrometer , tunning fork , rubber pad , copper sulphate bid details/ 2 / 142

CTN :40025203 Due date: 06 May, 202506 May, 2025 NA
Tender For supply of laboratory chemicals - aniline , acetic acid glacial ch3cooh toxic 500ml , xylene cap 2.5lt , isooctane ch3 3cch2ch ch3 2 540 84 1 50 , karl fischer reagent with , methanol dried sply 500 ml each , petroleum benzine 40 60 , petroleum benzine 60 80 , so propyl alcoho sply 5.0 lt can , poly ethylene glycol cap 230kg drum , diethyl ether sply 500 ml each , ammonium acetate , carbon disulfide , 1 butanol c4h10o c4h9oh cap 2.5lt bottl , sodium hydroxide , toluene cap 2.5lt , 2 propanol sply 2.5 lt each , mercuric sulfate hgso4 7783359 non flamm , 1 2 dimethoxyethane sply 1 lt each , 1 10 phenanthroline c12h8n2 cas 66 71 7 , 2 hexanone , silica gel 100 200 , iodine solution sply 3 amp pack each , sulfuric acid h2so4 7664939 non flammabl , univ indicator soln ph 4 11 sply 500 ml , toluene c6h5ch3 flammable 5l dr

State Government

CTN :40025276 Due date: 06 May, 202506 May, 2025 18.00 Lacs
Tender For supply of gapdh antibody rabbit , hepes buffer , dmg peg 2000 , electrophoresis power supply , electrophoresis apparatus , centrifuge tips autoclavable 10 ul , centrifuge tips autoclavable 200 ul , centrifuge tips autoclavable 1000 ul , storage glass bottle autoclavable 100 ml , storage glass bottle autoclavable 500 ml , storage glass bottle autoclavable 1000 ml , microfuge stands , microtube rack , conical tube racks , measuring cylinders 100 ml , measuring cylinders 500 ml , measuring cylinders 1000 ml , filtering membrane 0.22 micron , filtering membrane 0.45 micron , spray bottle , tissue rolls , autocolavable plastic bags , glass beakers 50 ml 100 ml , glass conical flasks 100 ml 200 ml 500 ml , antibiotic antimitotic solution , gloves , vacuum pump and discard apparatus , membrane filter holder 47mm , hemocytometer , disposable pipettes 1ml , disposable pipettes 2 ml , disposable pipettes 5 ml , disposable pipettes 10 ml , polyethersulfone membrane pore size 0.2 um , polyethersulfone membrane pore size 0.45 um , microcentrifuge tipbox , micropipette p10 1-10 ul , micropipette p20 2-20 ul , micropipette p200 20-200 ul , micropipette p1000 100-1000 ul , micropipette 0.5-10 ul , prestained protein ladder , multicolor low range protein ladder 250 ul , 8 channel multi channel pipette , glass pipettes 2 ml , glass pipettes 1 ml , glass pipettes 5ml , glass pipettes 10 ml , glass pipettes 0.1 ml , glass pipettes 0.2 ml , temed -ar grade , ficoll hypaque density gradient media -ar grade , formaldehyde -ar grade , cotton roll , petroleum ether -ar grade , n- butanol -ar grade , isopropanol -ar grade , agarose medium eeo -ar grade , glacial acetic acid -ar grade , methanol -ar grade , acetic acid aldehyde free -ar grade , ethanol -ar grade , sucrose - ar grade , butter paper sheets , tris-hcl , ether , methanol , acetyl acetone , sodium dodecyl sulfate , cryogenic tube with screw cap , cryo gloves , cryogenic boxes racks , cryogenic mini cooler , edta , acrylamide , bis acrylamide , ammonium per sulphate , lab spatula , precision weighing balance , pipet tips for gel loading

CTN :39983520 Due date: 24 Apr, 202524 Apr, 2025 8.22 Lacs
Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

CTN :39920637 Due date: 25 Apr, 202525 Apr, 2025 7.90 Lacs
Tender For supply of inj dobutamine 12.5 mg , mefenemic acid 250 mg plus dicyclomine hydrochloride 10 mg tab , quinine 300mg tab , levodopa 125 mg tab , topiramate 50mg tab , ethamsylate 250 mg tab , rivaroxaban 20 mg tab , mannitol 20 percent 100 ml bottle , benzocaine 20 percent pectin based oral ointment tube of 5 gm , triamcinalone acetonide 0.1 per for oral use tube of 5gm , cream silver sulphadiazine 1percent w v jar of 500 gms , triamcilone 10 mg inj , lignocaine 2.5 percent plus prilocaine 2.5 percent tube of 30gm , ear drop para dichlorobenzene 2 percent wv benzocaine 2.7 w v chlorbutol 5 percent turpentine oil 15 percent w v bott of 10ml clear wax , povidone iodine 7.5 percent solution 100 ml , 2 propanol 45 percent w w 1 propanol 30 percent w w ethyl hexadecyl dimethyl ammonium ethylsulphate mecetronium ethyl sulfate 0.2 percent w w bott of 500 ml brand bactorub blue raman and well , chloroxylenol solution potassium hydroxide 13.6 g chloroxynol soln 50.5g oleic acid 7.5ml castor oil 63.0g terpineal 100ml ethanol 96 pernt 200ml to rwc not les thn 3 dettol

State Government

CTN :39856264 Due date: 15 Apr, 202515 Apr, 2025 184
Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39816412 Due date: 24 Apr, 202524 Apr, 2025 NA
Tender For supply of platinum coated silicon wafer , titanium target , zinc target , cobalt target , titanium pellets , zinc pellets , cobalt pellets , alumina ceramic boat crucible , alumina ceramic crucible , thin films sample box , silver paste , fto substrates , ito substrates , nickel foam , carbon cloth , quartz tubes , kimwipes disposable wipers , silica gel
 Loading, Please wait...

Connect us via What's Up