Latest foleys catheter Tenders | Government foleys catheter Tenders

CTN :45511941

02 Jul, 2026 NA

Gaya - Bihar

Tender For supply of 250 mg , cap imatinib mesylate 100mg , cap fluvoxamine 50 mg , tab haloperidol 5mg , tab serratiopeptidase 5mg , tab gliclazide xr 60 mg plus metformin xr 500 mg , tab baclofen 10 mg , urdodesoxycholic acid 300 mg liver , amlodipine 2 point 5 mg , tab donepezil 5mg , tab medroxy progesterone 10mg , tamsulosin hcl 0 point 4 mg plus dutasteride 0 point 5 mg , tab rizatriptan 10 mg , zinc sulphate 20mg , tab isoxsuprine 10mg , tab digoxin 0 point 25 mg , indomethacin 25 mg tab oblique cap , diclofenac suppositories , tab methyldopa 250mg , succinylchloline chloride 50 mg oblique ml 2 ml inj , tab nebivolol 50 mg , tab indomethacin 75 mg sr tab , tab nitrofurantoin 100 mg , tab tramadol hcl 50 mg , tab etoricoxib 120 mg , esomeprazole 20 mg plus domperidone 30 mg , inj clindamycin 300 mg , qutiapine sr 100 mg , inj labetalol hcl 5mg oblique ml 4ml , tolperison 150 mg , ethamsylate 250 mg oblique 2 ml inj , thiocholchiside 8 mg , inj imipenem 500 mg , novel ravies monoclonal antibody cocktail containing docaravimab and miromavinab 600 iu oblique 1 ml , conjugated estrogen 0 point 625mg premarin , novel ravies monoclonal antibody cocktail containing docaravimab and miromavinab 1500 iu oblique 2 point 5 ml , inj adenosine 3 mg oblique ml 2 ml , indicator soda lime , tab dexamethasone 0 point 5 mg , pantoprazole 40mg plus domperidone 30 mg , inj lorazepam 2 mg oblique ml 2ml , tab isosorbide dinitrate 10 mg , tab ketorolac 10mg tab , tab trihexyphenidyl hcl 2 mg , tab silodisin 4 mg , tab atorvastatin 40 mg , esomeprazole 20mg , tab clomipramine hcl 25mg , inj lignocaine hcl solution 2 percent for iv use 50 ml without methyl rabite xylocaine , cap flucanozole 50 mg , tab ropinirole 0 point 25 mg , tab paroxetine 20 mg , aceclofenac 100mg plus serratiopeptidase 15mg plus paracetamol 325mg , tab betahestine 16 mg , dinoprostone pge2 10 mg pessary , l arginine collagen peptides type i sodium hyaluronate chondroitin sulfate and vitamin c tendocare forte , multivitamin with l methionine and selenium , cap vit a 50000iu , tab thiamine , amlodipine 5 mg plus telmisartan 40 mg , tab sitagliptin 50mg plus metformin 1gm , tab cyproheptadine 4 mg , tab phebnobarbitone 30 mg , tab enalapril 5mg , tab tenofovir 300mg , tab lamotrigine 50mg , tab sodium valproate cr 500 mg , acarbose 25 mg , pioglitazone 30 mg , tab hydrochlorothiazide 25mg , tab chlorpromazine 25mg , chlordiazepoxide 5 mg plus clidinium bromide 2 point 5 mg , tab topiramate 50mg , tab bicalutamide 50 mg , inj adrenaline tartrate 1 ratio 1000 1 ml , tab dutasteride 0 point 5mg , inj dopamine hcl 40 mg oblique ml 5ml , tab metoclopramide 10 mg , tab resperidone 4 mg , tab mefenamic acid 500mg , phenytoin sodium 300 mg , tab azathioprine 50mg , tab doxepin 25 mg , tab tenofovir alphamide 25 mg , tab carbimazole 5mg , tab telmisartan 40mg , tab trimethoprim and sulphamethoxazole ip cotrimazole ds , cap fluoxetine hcl 20mg , tab dienogest 2mg , tab enalapril maleate 2 point 5 mg , alendronate sodium 70mg tab , tab leflunomide 20 mg , tab bisacodyi 5mg , tab torsemide 20 mg , tab olmesartan 40mg , tab qutiapine 25 mg , ginkgo biloba 120 mg , sitagliptin 50 mg , piracetam 800 mg , tab piracetam 800mg and citicolin 500mg , rabies immunoglobulin , glucose saline isotonic solution in non toxic disposable plastic bott of 500ml ffs oblique dns , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape 30 cm , inj atropine sulphate 0 point 6 mg oblique ml , inj noradrenaline //bid details 2 / 130 bitartrate 2 mg oblique ml 2 ml , inj promethazine hcl 2 point 5 percent 25 mg oblique ml 2 ml , inj vasopressin 20 units oblique ml 1ml ampoule , inj oxytocin 5 units per 1 point 0 ml amp , inj thiamine , syp dextromethorphan hydrobromide and hlorpheniramine maleate syrup bott of 60 ml for pediatric tixlic , tiotropium bromide 9 mcg 120 metered doses oblique unit inhaler , inj magnesium sulphate 50 percent w oblique v , ipratropium bromide respirator soln 500

CTN :45511978

23 Jun, 2026 NA

Jalpaiguri - West Bengal

Tender For supply of introducer size 3.0 , proseal laryngeal mask airway with gastric suction port with introducer size 4.0 , proseal laryngeal mask airway with gastric suction port with introducer size 5.0 , quincke spinal needle 26g 90mm , skin disinfectant 100 gm isoproponol 63 gm, benzalkonium bott of 500 ml , spray diclofenac analgesic , spray lignocaine topical aerosol lox 10 spray , spinal needle size- 25 26 g 25 each size , sterile swab stick , sterile urine containers 50 ml , suction catheter s-12 fr , suction catheter s-14 fr , suction catheter s-16 fr , suture monocryl 3-0 cutting body , suture polyamide monofilament 2-0 cb , suture polyamide monofilament no 1 cb , suture polydioxanone loop no 1 rb , suture vicryl 2by0 rb , suture vicryl rapid 3-0 cutting needle 26 mm , usg guided plexus block needle - sono plex 21g x 100mm , usg guided plexus block needle - sono plex 21g x 50 mm , usg guided plexus block needle - sono plex 22g x 100mm , usg guided plexus block needle - sono plex 22g x 50 mm , usg guided plexus block needle - sono plex 22g x 75mm , central line dressing , et tube pvc micro cuff size 8.5 with cuff , et tube reinforced cuff size 3 with cuff , et tube reinforced cuff size 3.5 with cuff , et tube reinforced cuff size 4 with cuff , et tube reinforced cuff size 4.5 with cuff , durapore 1 inch , durapore 3 inch , chlorinated lime with boric acid , skin stapler removal , bain cercuit paed , foleys catheter silicon two way s-12f , foleys catheter silicon two way s-14f , foleys catheter silicon two way s-18f , closed wound suction set s-8 , closed wound suction set s-10 , warming blanket paediatric , transducer hand piece compatible with gen-11 generator hp054 , laparoscopic probe 36cm compatible with gen-11 generator har 36 , ace coagulating shears 23cm ergonomic compatible with gen-11 generator har 23 , sterofundin iso 500ml , tubal ring for laproscopic sterilization , tegaderm , disposable irrigation aspiration bimanual han piece , disposable ophthalmic surgical crescent blade , disposable ophthalmic surgical 15 degree side port blade , disposable ophthalmic surgical 2.8 mm keratome blade , double bevel, 15 degrees, opthalmic blade 2.8 mm grip , double bevel, 45 degrees, sterile disposable opthalmic blade 2.8 mm grip , endo loop sterilized suture catgut ,pre-knotted ligature for endo surgery , ryles tube size 14 , ryles tube size 16 , ryles tube size 18 , disposable sterile endoscopic camera cover 25 cm x 2.5 mt , absorb surgi suture polyglactin 36mm, 1by 2 circle reverse cutting double needle adult bougie, band aid , battery aa, battery aaa, battery for glucometer, battery rechargable aa, battery rechargable aaa, catheter suction endo bronchial with terminal pvc tubing 08 fg 50 cms , catheter suction endo bronchial with terminal pvc tubing s16 fg l50 cms , central venous catheter 7.0 fg -(16 cm) triple lumen seldinger needle, condom drainage, corn cap pkt of 4 pieces, bp cuff for digital bp apparatus, disinfectant powder contains oxone dodecylbenzenesulfonate, sulfamic acid, disinfectant contains 1,6 dihydroxy 2.5 dioxyhexglutaralde,benzalkonium , disposable cautery lid, disposable circuit ventilator adult, disposable laryngoscope size 4, disposable y patient circuit, electrocautery pencil for medilap 400 mfu, epidural epi-fix , test card with creatinine & calcium for abg machine, gum elastic bougie, hme filter, i gel size 1, i gel size 1.5, i gel size 2, i gel size 2.5, i gel size 3, i gel size 4, inhaler budesonide 100mcg, inj carbetocin 100mcg/ml, inj ropivacaine hydrochloride in dextrose heavy 0.75% 4ml, inj suggamadex 100mg/ml 2ml, intralipid 20% //bid details 2 / 82

Central Government/Public Sector

CTN :45512021

02 Jul, 2026 9.50 Lacs

Kamrup - Assam

Tender For supply of n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45512256

02 Jul, 2026 NA

Gwalior - Madhya Pradesh

Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

CTN :45512728

22 Jun, 2026 NA

East Sikkim - Sikkim

Tender For supply of eppendrof tube 0.5 ml plastic pkt of 100 , sample cup system pack for em 200 pkt of 500 , xl - multical system pack for em 200 4 3 ml , erba norm 1 x 5 ml , erba path 1 x 5 ml , glucose god pod system pack for em 200 10 x 44 ml , urea system pack for em 200 5 x 44 ml 5 x 11 ml , cholesterol system pack for em 200 10 44 ml , triglyceride system pack for em 200 5 x 44 ml 5 x 11 m , direct hdl system pack for em 200 4 x 30 ml 4 x 10 ml , uric acid system pack for em 200 5 x 44 ml 5 x 11 ml , total protein system pack for em 200 5 x 44 ml 5 x 11 ml , albumin system pack for em 200 10 x 44 ml , sgot el system pack for em 200 6 x 44 ml 6 x 12.5 ml , sgpt el system pack for em 200 6 x 44 ml 6 x 12.5 ml , alkaline phosphatase system pack for em 200 2 x 44 ml 2 x 11 ml , amylase system pack for em 200 5 x 22 ml , lipase xl system pack for em 200 1 x 44 ml 1 x 11 ml , ldh - p system pack for em 200 2 x 44 ml 2 x 11 ml , ggt system pack for em 200 2 x 44 ml 2 x 11 ml , calcium a system pack for em 200 5 x 6 ml , phosphorous system pack for em 200 5 x 6 ml , micro protein with cal system pack for em 200 5 x 6 ml , micro albumin control system pack for em 200 1 x 1 ml , micro albumin with cal system pack for em 200 1 x 5 ml 2 x 25 ml , contro h aso rf crp system pack for em 200 1 x 1 ml , control aso rf crp system pack for em 200 1 x 1 ml , xl crp with calibrator system pack for em 200 2 x 22 ml 1 x 11 ml , ec-90 pm kit , single blood collection bag 350ml , gram stain , sterile swab stick , chloroform ar analytical grade * /bid number : gem/2026/b/7577965 + /dated: 11-06-2026 ' ' / bid document 1 / 29

CTN :45512770

22 Jun, 2026 NA

East Sikkim - Sikkim

Tender For supply of eppendrof tube 0.5 ml plastic pkt of 100 , sample cup system pack for em 200 pkt of 500 , xl - multical system pack for em 200 4 x 3 ml , erba norm 1 x 5 ml , erba path 1 x 5 ml , glucose god - pod system pack for em 200 10 x 44 ml , urea system pack for em 200 5 x 44 ml oblique 5 x 11 ml , cholesterol system pack for em 200 10 x 44 ml , triglyceride system pack for em 200 5 x 44 ml oblique 5 x 11 m , direct hdl system pack for em 200 4 x 30 ml oblique 4 x 10 ml , uric acid system pack for em 200 5 x 44 ml oblique 5 x 11 ml , albumin system pack for em 200 10 x 44 ml , sgot - el system pack for em 200 6 x 44 ml oblique 6 x 12.5 ml , sgpt - el system pack for em 200 6 x 44 ml oblique 6 x 12.5 ml , alkaline phosphatase system pack for em 200 2 x 44 ml oblique 2 x 11 ml , amylase system pack for em 200 5 x 22 ml , lipase xl system pack for em 200 1 x 44 ml oblique 1 x 11 ml , ldh - p system pack for em 200 2 x 44 ml oblique 2 x 11 ml , ggt system pack for em 200 2 x 44 ml oblique 2 x 11 ml , calcium a system pack for em 200 5 x 6 ml , phosphorous system pack for em 200 5 x 6 ml , contro haso oblique rf oblique crp system pack for em 200 1 x 1 ml , contro laso oblique rf oblique crp system pack for em 200 1 x 1 ml , xl crp with calibrator system pack for em 200 2 x 22 ml oblique 1 x 11 m , pt reagent kit of 25 tests , diluent 20 ltrs for genrui automated hematology analyser , lh lyse 200 ml for genrui automated hematology analyser , diff lyse 500 ml for genrui automated hematology analyser , cbc -dh hematology control for genrui kt-6610 , cell pack 20ltr , stromatolyser , kit for estimation of cpk ck-nac 2x8 oblique 2x2 ml , strips albumin and glucose bottle of 100strips , rapid card screening for hcv , leishmans stain, rtu, bottle of 500 ml , reticulocyte stain, rtu, bottle of 500 ml , zn stain , hiv antibody 1 and 2 detection rapid test kit , occult blood test kit of 50 tests , semi auto hematology cell counterprintin paper roll , disposable esr tube , c reactive protein kit for 50 tests , widal kit , typhi dot test kit 30 test oblique kit , sterile petri dish medium 90 mm , urs- 10 urine reagent strips for urinalysis siemens , rapid card test for vdrl , strile urine container , leica 818 high profile microtome blades pkt of 50 blades , syringe 10 ml , syringe 5 ml , syringe 2 ml , sterile vacutainer , k3 edta vacutainer , sodium fluoride vacutainer , powder free gloves, latex, gamma irridation, size 6.5 , powder free gloves, latex, gamma irridation, size 7 , powder free gloves, latex, non sterile disposable gloves, , size 7 , micropipette, tips for 1-200 ul pack of 96 tips , micropipette, tips for 500-1000 ul pack of96 tips , chloroform ar analytical gade , gram stain , ra factor kit //bid details 2 / 51

CTN :45513210

22 Jun, 2026 NA

Siang - Arunachal Pradesh

Tender For supply of aed machine , body fat analyser , smart ring , glucometer with strips , continuous glucose monitoring , ecg fold paper

Central Government/Public Sector

CTN :45513745

29 Jun, 2026 NA

Kodagu - Karnataka

Tender For supply of sterile disposable umbilical cord , sterile surgical , suction , surgical , ultrasound , urine collection , infant feeding , sterile disposable , sterile surgical , nitrile examination sterile , foleys catheter , black braided silk 3 or 8 , blood sugar , disposable , ecg , b.b silk 3 or 8 , inj. t t , plastic aprone , autoclave indicator , easy fix or vaso fix , spirit , rubber sheet , syringe 20 ml , syringe 10 ml , syringe 50 ml , glycerine , mgso4 cristal for dressing , tab. hyosine , tab. dicyclamine , inj. hyosine , diclofenac gel , inj vitamin -k , ciprofloxacilline , cotrimazole , sporolac , pipericilline with tazobactum , mefthal p , sy liquide paraffine , sy. lactulose , fluoxitine , flunerazine , clobazam

CTN :45516768

26 Jun, 2026 10.00 Lacs

Jabalpur - Madhya Pradesh

Tender For supply of phenolphthalin , pthalic acid , potassium chromate , potasssium ferrocynide , potassium nitrite , wire gauge , stalogmometer , viscormeter , copper turning , chemical balance electronic , acetic acid glacial- er , acetic acid , ammonium solution , ammonium bromide , ammonium sulphate , acetaldehyde , acetone , aniline , activated charcol , ammonium molybdate , barium chloride , barium sulphate , benedict solution , benzoic acid , benzene , benzeldehyde , bromine water , cadmium sulphate , silver nitrate , sodium carbonate , sodium chloride , sodium hydroxide , sodium iodide , sodium metal in liqiud parrafin , sodium nitroprusside , sodium sulphate , sodium thio sulphate , starch , sucrose , sulphuric acid , sodium bi carbonate , succinic acid , slicylic acid , stanus chloride , silica gel , sodium acetate , shiff reaget , tartaric acid , toluence , tollen reagent , urea , thio urea , zinc acetate , zinc chloride , zinc bromide , zinc sulphate , glucose , ammonium oxalate , ammonium per sulphate , gycerol , nesslers reagent ammnium , n butanol , n hexane , ninhydrin

Central Government/Public Sector

CTN :45516847

26 Jun, 2026 NA

Mysore - Karnataka

Tender For supply of fumigation liquid 2 per w v glutaraldehyde 5 per w v benzalkonium chloride solution ip corrosion inhibitors , inj pantaprazole , blood glucose strips for every thousand strips one glucometer , spinal needle 25g , gelatin sponge , surgical blade no 20 , povidine iodine solution 5 per , pop rolls 10cms , pop rolls 15cms , tab ranitidine 150mg

Foleys Catheter Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector