Web Analytics Made Easy - StatCounter

Glucose Tenders

Get complete information related to latest Glucose Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Glucose Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Glucose Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :45543063 Due date: 24 Jun, 202624 Jun, 2026 39.97 Lacs
Tender For supply of sulphasalazine 500 mg tab , inj ondansetron 2 mg ml , ketoconazole 2 pcnt zinc pyrithione 1 pcnt lotion 60 ml , inj pantoprazole 40 mg , atracurium 10 mg ml 2 pnt 5 ml inj , theophylline sr 400 mg tab , thiamine 100mg tab , thiocolchicoside 4 mg tab , topiramate 25 mg tab , tramadol 50 mg cap , tretinoin 0 pnt 025 pcnt oint tube of 15 gm , desvenlafaxamine 50 mg tab , xylometazoline 0 pnt 1 pcnt w v nasal drops bott of 10 ml , fuji film dry imaging films di hl 8 x10 pac pkt of 150 , fuji film dry imaging films di hl 10 x12 pac pkt of 150 , fuji film dry imaging films di hl 11 x14 pac pkt of 150 , disposable ceasarean kit , sodium chromoglycate e d 2 pcnt , acamprosate calcium 333 mg tab , dressing first aid unmedicated sterile strip size 1 x3 , clotrimazole 1 pcnt ear drops botts of 10 ml , donepezil 5 mg tab , escitalopram 10 mg tab , hyoscine butylbromide 20mg ml 1 ml inj , metronidazole inj for iv use containing 500 mg per bott of 100 ml , lacosamide 50 mg tab , lactobacilllus 1 gm sachet , lorazepam 2 mg tab , pyridoxine 100 mg tab , rabeprazole 20mg plus itopride 50mg tab , ranolazine 500 mg tab , riboflavin 10 mg tab , silver nitrrate 0 pnt 2 pcnt chlorhexedine 0 pnt 2 pcnt oint 15 gm , sodium chloride 5 pcnt eye drops bott of 10 ml , solifenacin 5 mg tab , sulphacetamide 20 pcnt w pnt v e d amber self dropper bott 10 ml , terbinafine 1 pcnt cream tube of 10 gm , torsemide 100 mg tab , triamcinalone 0 pnt 1 pcnt w w for oral use tube of 10 gm , verapamil 120mg sr tab , warfarin 1mg tab , anti sera a kit estimat bld group abd contain anti sera a b and anti d 5 ml , cholesterol kit , cover glass strips 22 x 55 mm , creatinine kit , crp kit span , dengue test kit ns1 antigen igg and igm kit of 10 tests , esr disposable pipette pack of 100 , hbsag kit , hcv tri dot rapid card pack of 100 tests , hdl kit , ketodiastix strip , ketostick bott 100 strip , kit for estimation of alkaline phosphate , kit for estimation of bilirubin pnt , kit for estimation of cholestrol pnt , kit for estimation of glucose pnt , kit for estimation of hdl pnt , kit for estimation of triglyceride pnt , kit for estimation of uric acid pnt , lancet needle , leishman stain solution ready to use bott of 500 ml , malaria ag pf pv rapid card pack of 50 tests , slide microscope thickness 1 pnt 15 to 1 pnt 35 mm size 75 mm x 25 mm , rapid card test for pregnancy , sgot kit , sgpt kit erba , test tube 100x12mm , triglyceride , typhoid igg igm rapid test kit of 30 tests , urea kit , uric acid , urine container disposable , vaccum blood collection tube sterile with sodium fluoride pnt 2 3 ml , vaccutainer needle , widal test , h 360 dilute 20 , h 360 lyse 500 ml , elite h clean 50 ml , hdl cholestrol fs 4x200 test for diasys , ldl cholestrol fs 4x200 test for diasys , ra factor fs 2x20 ml , crp latex reagent , crp rapid card , widal //bid details 2 / 68

CTN :45543344 Due date: 29 Jun, 202629 Jun, 2026 7.00 Lacs
Tender For supply of , centrifugation machine with tube , stop watch digital , fine capillary tube pkt , safety glass , gas supply kit , chromatography sheet whatman no 1 of 30 mtr , water bath with rings , round bottom flask 250 ml , gas passing tube 20 ml , test tube stand plastic , acetic acid glacial 500 ml , aluminium acetate 250 gm , aluminium nitrate 500 gm , ammonia solution 500 ml , ammonium acetate 500 gm , ammonium bromide 500 gm , ammonium sulphate 500 gm , aniline 500 ml , baking soda sodium bicarbonate ninety nine percent 500 gm , barium chloride 500 gm , barium sulphate ninety seven point five percent to hundred percent 500 gm , benedicts solution 500 ml , cadmium sulphate 100 gm , calcium carbonate 500 gm , calcium chloride fused 99 percent 500 gm , carbon disulphide 99 percent 500 ml , cobalt sulphate 100 gm , copper nitrate 95 to 103 percent cupric nitrate 500 gm , distilled water 20 ltr , fehling a solution 500 ml , fehling b solution 500 ml , ferric chloride solution anhydrous 500 gm , ferric sulphate fe 22 percent 500 gm , ferrous ammonium sulphate mohrs salt 500 gm , ferrous sulphate 500 gm , hydrochloric acid thermocole pack two point five ltr , hydrogen peroxide solution 30 percent w by v 500 ml , ceric ammonium nitrate 200 gm can , isopropyl alcohol 99 percent 500 ml , lead acetate 500 gm , liquid parrafine 500 ml , magnesium nitrate 500 gm , manganese carbonate 500 gm , manganese chloride 500 gm , methyl orange solution 125 ml , molish reagent 125 ml , napthalene beta 2-naphtho 250 gm , napthalene powder 99 percent 500 gm , oxalic acid ninety nine point five percent 500 gm , phenol carbolic acid 99 percent 500 gm , potassium hydrogen sulphate , potassium chloride 500 gm , silver nitrate 100 gm , sodium chloride 500 gm , potassium permanganate 500 gm , sodium carbonate anhydrous 500 gm , sodium hydroxide 500 gm , sodium iodide 100 gm , sodium metal 99 percent in liquid paraffin 250 gm , sodium sulphate anhydrous 96 percent 500 gm , sodium thiosulphate 500 gm , starch soluble 500 gm , sucrose 500 gm , sulphuric acid two point five ltr oleum , universal indicator solution 500 ml , zinc acetate 500 gm , zinc bromide 99 percent 250 gm , zinc sulphate 99 percent 500 gm , benzoic acid 500 gm , phenolphthaline indicator 100 ml , aluminium metal powder 250 gm , calcium hydroxide 500 gm , calcium oxide 500 gm , cobalt chloride 100 gm , glycerine 500 ml , litmus blue solution 125 ml , litmus red solution 125 ml , magnesium ribbon 25 gm , methelene blue solution 125 ml , methyle alcohol 500 ml , potassium dichromate 500 gm , sulphur powder 500 gm , ethanol two point five ltr , nitric acid two point five ltr , phosphoric acid 1 ltr , sodium nitrate 500 gm , carbon tettra chloride 500 ml , zinc chloride 500 gm , schiff reagent 500 ml , tollens reagent , glucose 500 gm , millions test 100 ml , cobalt nitrate 500 gm , potassium iodide 500 gm , cadmium carbonate 250 gm , diphenylamine 100 ml , manganese dioxide 500 gm , copper chips 500 gm , benzaldehyde 500 ml , potassium nitric 500 gm , barium carbonate 500 gm , strontium carbonate 500 gm , calcium acetate 500 gm , plain stickers or label //bid details 2 / 108 pkt , potassium nitrate 500 gm , magnesium sulphate 500 gm , ammonium phosphate 500 gm , sodium bromide 500 gm , strontium nitrate 500 gm , sodium sulphide 500 gm , zinc metal granulated 250 gm , 2 4 dnp 200 gm , acetaldehyde 500 ml , acetone 500 ml , nickel carbonmate 500 gm , nickel sulphate 500 gm , magnesium chloride 500 gm , sodium hydrogen sulphate 500 gm , cobalt acetate 500 gm , chloroform 500 ml , sodium sulphite 500 gm , picric acid 250 gm , borex 500 gm , aluminium metal 250 gm , aluminium chloride 500 gm , potassium iodate 500 gm , red ink 200 ml , aluminium sulphate 500 gm , acetic anhydride 500 ml , acetanilide 200 gm , potassium sulphate 500 gm , ammonium oxailate 500 gm , ammonium molybitate 250 gm , potassium ferrocyanide 500 gm , copper sulphate 500 gm , mercuric chloride 200 gm , sodium acetate 500 gm

CTN :45543708 Due date: 23 Jun, 202623 Jun, 2026 11.37 Lacs
Tender For supply of ra factor test kit qualitative 1 into 100 tests , disposable esr pippette 2.40 by single piece , urine pregnancy strip , buffer ph 6.8 , c-reactive protein crp qualitative 1 into 100 tests , rapid test for dengue igg igm and ns1ag , glucose pulv , rapid typhoid igg by igm , pt reagent 12 into 5ml erba , malaria paracheck pv by pf rapid test , widal kit , alcohol dehydrated ethyl , urine multistick 10 sg siemens , microscopic glass slide 76mm into 26mm , disposable embadding ring , pttk reagent with calcium chloride ecl 105 , src -10 pt test tube ecl 105 , electrolyte pack acumedica cal a 300 cal b 200 , paraffin wax melting point 60o to 62o , leptospira rapid card test , scrub typhus rapid card test , petri desh disposable , swab stick , microtome low profile blade lecia , vit d standard f , lh standard f , fsh standard f , prolaction standard f , tsh standard f , t4 standard f , t3 standard f , standard f pct , standard f hbaic , standard f ckmb , standard f crp quantitive , standard f -d dimer , truenat scrub typhus pcr , truenat dengue pcr , truenat leptospira pcr , trueprep auto universal sample pretreatment for non-mtb sample , trueprep autov2 universal cartridge based sample preparation kit , acu media control low high medium , cal a compatible with micro ab electrolyte analyzer , cal b compatible with micro lab electrolyte analyzer , hiv tri dot rapid test , urea - system pack 5into 4 by 5 into 11 ml erba , ldl cholesterol with calibrator 2into30by2into10ml erba , cholesterol - system pack 10 into 44 ml erba , uric acid system pack 5 x 44by 5 into 11 ml erba , triglyceride - system pack 5 into 44by5into 11 ml erba , h d l cholesterol with calibrator system pack 4 into 30 by 4 into 10 ml erba , lipase system pack 2 into 44 by 2 into 11 ml erba , ggt system pack 2 into 22ml by 2into 6.8ml erba , hba1c with calibrator system pack 2 into 44 by 2 into 15 ml erba , ck - system pack 2 into 44 by 2 into 11 ml erba , ck mb system pack 2 into12 by 2 into 3 ml erba , calcium system pack 10 into 44 ml erba , s g o t el system pack 6 into 44 by 3 into 22 ml erba , s g p t el system pack 6 into 44 by 3 into 22 ml erba , xl multical system pack 4 into 3 ml erba , fe 4 into 25 by 4 into 6.5 ml erba , ldh system pack 2 into 44 by 2into 11 erba , uibc system pack 4 into25 by 4 into 6.5 ml erba , d bilirubin system pack 6 into 44 by 3 into 22ml erba , total bilirubin-system pack 6 into 44 by 3 into 22ml erba , alp -system pack 2 into 44 by 2 into 11ml erba , amylase system pack 5 into 22ml erba , creatinine - system pack 5 into 44 by 5 into 11 ml erba , erba auto wash system pack 10 into 100ml erba , total protein system pack 10 into 44ml erba , albumin system pack 10 into 44ml erba , am - kit for di plant 10l ph for distiller of em 200 biochemistry analyser erba //bid details 2 / 59

CTN :45543928 Due date: 23 Jun, 202623 Jun, 2026 1.78 Lacs
Tender For supply of kits for estimation of cholesterol 100ml , kits for estimation of glucose 400ml , drabkins solution , strips albumin and glucose bott of 100 strips , urine collection bott 50ml , syringe disposable plastic sterile 5 ml with needle , tube test 100 mm x 12 mm rimless , cell pack pack of 20 ltr , cell clean bott of 50ml , stromatolyser bott of 500ml

CTN :45511941 Due date: 02 Jul, 202602 Jul, 2026 NA
Tender For 250 mg , cap imatinib mesylate 100mg , cap fluvoxamine 50 mg , tab haloperidol 5mg , tab serratiopeptidase 5mg , tab gliclazide xr 60 mg plus metformin xr 500 mg , tab baclofen 10 mg , urdodesoxycholic acid 300 mg liver , amlodipine 2 point 5 mg , tab donepezil 5mg , tab medroxy progesterone 10mg , tamsulosin hcl 0 point 4 mg plus dutasteride 0 point 5 mg , tab rizatriptan 10 mg , zinc sulphate 20mg , tab isoxsuprine 10mg , tab digoxin 0 point 25 mg , indomethacin 25 mg tab oblique cap , diclofenac suppositories , tab methyldopa 250mg , succinylchloline chloride 50 mg oblique ml 2 ml inj , tab nebivolol 50 mg , tab indomethacin 75 mg sr tab , tab nitrofurantoin 100 mg , tab tramadol hcl 50 mg , tab etoricoxib 120 mg , esomeprazole 20 mg plus domperidone 30 mg , inj clindamycin 300 mg , qutiapine sr 100 mg , inj labetalol hcl 5mg oblique ml 4ml , tolperison 150 mg , ethamsylate 250 mg oblique 2 ml inj , thiocholchiside 8 mg , inj imipenem 500 mg , novel ravies monoclonal antibody cocktail containing docaravimab and miromavinab 600 iu oblique 1 ml , conjugated estrogen 0 point 625mg premarin , novel ravies monoclonal antibody cocktail containing docaravimab and miromavinab 1500 iu oblique 2 point 5 ml , inj adenosine 3 mg oblique ml 2 ml , indicator soda lime , tab dexamethasone 0 point 5 mg , pantoprazole 40mg plus domperidone 30 mg , inj lorazepam 2 mg oblique ml 2ml , tab isosorbide dinitrate 10 mg , tab ketorolac 10mg tab , tab trihexyphenidyl hcl 2 mg , tab silodisin 4 mg , tab atorvastatin 40 mg , esomeprazole 20mg , tab clomipramine hcl 25mg , inj lignocaine hcl solution 2 percent for iv use 50 ml without methyl rabite xylocaine , cap flucanozole 50 mg , tab ropinirole 0 point 25 mg , tab paroxetine 20 mg , aceclofenac 100mg plus serratiopeptidase 15mg plus paracetamol 325mg , tab betahestine 16 mg , dinoprostone pge2 10 mg pessary , l arginine collagen peptides type i sodium hyaluronate chondroitin sulfate and vitamin c tendocare forte , multivitamin with l methionine and selenium , cap vit a 50000iu , tab thiamine , amlodipine 5 mg plus telmisartan 40 mg , tab sitagliptin 50mg plus metformin 1gm , tab cyproheptadine 4 mg , tab phebnobarbitone 30 mg , tab enalapril 5mg , tab tenofovir 300mg , tab lamotrigine 50mg , tab sodium valproate cr 500 mg , acarbose 25 mg , pioglitazone 30 mg , tab hydrochlorothiazide 25mg , tab chlorpromazine 25mg , chlordiazepoxide 5 mg plus clidinium bromide 2 point 5 mg , tab topiramate 50mg , tab bicalutamide 50 mg , inj adrenaline tartrate 1 ratio 1000 1 ml , tab dutasteride 0 point 5mg , inj dopamine hcl 40 mg oblique ml 5ml , tab metoclopramide 10 mg , tab resperidone 4 mg , tab mefenamic acid 500mg , phenytoin sodium 300 mg , tab azathioprine 50mg , tab doxepin 25 mg , tab tenofovir alphamide 25 mg , tab carbimazole 5mg , tab telmisartan 40mg , tab trimethoprim and sulphamethoxazole ip cotrimazole ds , cap fluoxetine hcl 20mg , tab dienogest 2mg , tab enalapril maleate 2 point 5 mg , alendronate sodium 70mg tab , tab leflunomide 20 mg , tab bisacodyi 5mg , tab torsemide 20 mg , tab olmesartan 40mg , tab qutiapine 25 mg , ginkgo biloba 120 mg , sitagliptin 50 mg , piracetam 800 mg , tab piracetam 800mg and citicolin 500mg , rabies immunoglobulin , glucose saline isotonic solution in non toxic disposable plastic bott of 500ml ffs oblique dns , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal swab 40 x 25 cm with tape 30 cm , inj atropine sulphate 0 point 6 mg oblique ml , inj noradrenaline //bid details 2 / 130 bitartrate 2 mg oblique ml 2 ml , inj promethazine hcl 2 point 5 percent 25 mg oblique ml 2 ml , inj vasopressin 20 units oblique ml 1ml ampoule , inj oxytocin 5 units per 1 point 0 ml amp , inj thiamine , syp dextromethorphan hydrobromide and hlorpheniramine maleate syrup bott of 60 ml for pediatric tixlic , tiotropium bromide 9 mcg 120 metered doses oblique unit inhaler , inj magnesium sulphate 50 percent w oblique v , ipratropium bromide respirator soln 500 mcg obliqu

Central Government/Public Sector

CTN :45512021 Due date: 02 Jul, 202602 Jul, 2026 9.50 Lacs
Tender For n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45512256 Due date: 02 Jul, 202602 Jul, 2026 NA
Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

Central Government/Public Sector

CTN :45546655 Due date: 22 Jun, 202622 Jun, 2026 NA
Tender For supply of glucose kit (god-pod) with standard for auto analyzer & semi auto analyzer-- incubation time less than or equal to 8 minutes- flow cell temperature 37c -with program sheet for olympus au - 400 [ warranty period: 30 months after the date of delivery ] ]

Central Government/Public Sector

CTN :45548852 Due date: 25 Jun, 202625 Jun, 2026 NA
Tender For supply of glucose (liquid), 9x51ml. in per pack. (item no. 4474 (pac) of ami 2026 - 27).[quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ] ]

Central Government/Public Sector

CTN :45551698 Due date: 06 Jul, 202606 Jul, 2026 NA
Tender For supply of blood glucose test strip , blood groupkit , cotton , rapid diagnostic card , disposable syringe , disposable needle , ecg paper roll , ecg paper roll , hiv rdk , hbsag rdk , lancets , malaria card , rapid diagnostic card , surgical sprit , gloves surgical rubber , troponin enzyme test card , urine test strip , typhoid test kit
 Loading, Please wait...

Connect us via What's Up