Latest hexamethylenetetramine Tenders | Government hexamethylenetetramine Tenders

Central Government/Public Sector

CTN :40025038

07 May, 2025 4.20 Lacs

Sambalpur - Odisha

Tender For supply of lab equipment - charts , models , slide permanent , specimens , pictures posters charts , beaker , dropping bottle , forceps , funnel , micro viewers , microscope , petri dish , pipette , skeleton , test tube holders , test tube stand , watch glass , water bath , wash bottle , burette , capillary tube , thermometer , ammonium solution , chromatography paper , formaldehyde , glycerine , robert solution , micro cover slip , micro glass slides , millions reagent , needle , nitric acid , sucrose , test tube ordinary , ph paper , blade for section cutting , acetic acid , brushes , blow pipe , burette stand , test tube brush , cork borer , cork presser , crucible tongs , charcoal slab borer , crucible , deflagrating spoon , distilation apparatus , drying cones , funnel stand or filter stand , pestle and mortar , pinch cock , retort stand , round file , sand bath , spirit lamp , test tube stand , test tube holder , triangular stand , tripod stand , trough , wire gauze , triangular clay pipes , beehie sheft , burettle , china dish , conical flasks , dessicator , gas jar dises , flasks , gas jar or cylinder , glazed tile , measuring flasks , retort , thistle funnel , woulfes apparatus , watch glass , ammonium carbonate , ammonium chloride , ammonium sulfate , ammonium bromide , aluminum sulfate , iron sticks , potassium nitrite , ammonium oxalate , sodium thiosulphate , zinc sulfate , cobalt nitrate , sodium hydroxide , copper sulfate , potassium nitrate , oxalic acid , magnesium sulfate , magnesium chloride , ammonium phosphate , sodium chloride , potassium ferrocyanide k4fe cn 6 , ferrous sulfate , sodium bromide , ammonium ferrous sulfate , potassium dichromate , barium chloride , strontium nitrate , sodium sulphide , potassium chromate , lead acetate , sodium sulfate , potassium iodide , lead nitrate , cedric ammonium nitrate , 2,4 dnp , universal indicator , ammonia solution nh4oh , phenol , aniline , bromine water , acetaldehyde , fehling solution a b , acetone , carbon disulfide , phenolphthalein , nesslers reagent , ammoniumm olybdate , nickel carbonate , nickel sulfate , manganese chloride , calcium chloride , sodium bisulphate. , cobalt acetate , chloroform , magnesium ribbon , zinc granual , lead nitrate pb no3 2 , potassium iodide ki , lead metal pb , ethyl acetate , sodium metal , pottasium permanganet kmno4 , pottasium dichromate k2cr2o7 , hydro chloric acid hcl , sulphuric acid h2so4 , nitric acid hno3 , ethanol , test tube , test tube holder , dropper glass , filter paper , glass rod , sodium sulfite , picric acid , borax , cobalt glass , aluminum metal , spatula , laboratory thermometer , drawing board , friction apparatus complete set with weight box , parallelogram apparatus , helical spring apparatus with weights , resonance apparatus , spherometer , screw gauge , wooden scale , stopwatch , sonometer set , sprit level , vernier calliper , beakers , connecting wires , concave mirror , convex mirror , convex lens , concave lens , glass slab , pendulum bob , cork rubber , hanger weights , metalic bob , slinky spring , spring balance , copper calorimeter , wave pendulum , barometer tube , lactometer , proof plane , boyles law apparatus , fortnis barometer , metallic cylinders brass , metal sphere , youngs modulus apparatus , hydrometer , tunning fork , rubber pad , copper sulphate bid details/ 2 / 142

CTN :39983520

24 Apr, 2025 8.22 Lacs

Bhopal - Madhya Pradesh

Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

State Government

CTN :39926120

22 Apr, 2025 NA

Multi City - Andhra Pradesh

Tender For procurement and supply of medicines - halothane for inhalation (contains halothane bp), 250ml phenytoin sodium injection ip 50mg/ml in, 5ml vial 5-fluorouracil injection ip 250 mg /5 ml in 5 ml, amp mephentramine, sulphate injection 30, mg /ml in 10 ml vial, salbutamol nebuilising, solution ip 10ml, labetalol hcl injection ip, 5mg / ml in 10ml vial, adenosine injection ip, 3mg / ml 2ml vial or, ampoule, bupropion hcl tablets, 150 mg usp, cyclosporine capsules, usp 25 mg, flutamide tablets usp, 250 mg, ichthymol 1.5gm, glycerine upto 15ml nfl, iii, methimazole tablet 5mg, methotrexate tablets ip, 2.5 mg, methotrexate injection, ip 50 mg / ml in 2ml, amp, valthemine bromide, injection 8mg /ml., fluconazole for oral, suspension 50mg per, 5ml (pack size : 35ml), 5-fluorouracil injection, ip 500 mg/10 ml in, 10ml amp, barium sulfate, suspension 100% w/w, 340 gms, calciferol oral drops 75, mcg/ml 20 ml, ropivacaine injection, 0.75mg%, 10ml vial, benzathene penicillin la, 12 lakh injection 1 gm /, vial, canagliflozin tablet, 100mg, capd (continuous, ambulatory peritoneal, dialysis) solution set, 4.25%, 2 litres bag with, integrated asymmetric, y. set, tab.orciprenaline 10mg, tab.propylthiouracil 50, mg, tab.pentoxiphylline, 400mg, sodium chloride, solution for irrigation, 0.9%-5ltr, tab.azathioprine 100mg, inj.basal insulin, analogues 300 iu/ml, betoxolol eye drops, 0.50%, biosaftey liquid -4, solution-5ltr, tab.cyclosporine, 200mg, cap formetrol fumerate, inhalation 6mcg, tab.cyclosporine 100mg, inj.etomidate 2 mg /ml,, 20mg/10 ml vial, gatifloxacin eye, ointment 0.3%, inj.hyperbaric, levobupivacaine 0.5/4, ml amp, inj butorphanol 2 mg,, amp for im/iv, inj carbetocin 100, mcg/ml, inj lidocaine 2%, preservative free 50 ml, multi dose vial, inj phenylephrine 2ml, inj.levobupivacaine, isobaric 0.5/20 ml vails, tab.levonorgestrel, releasing intrauterine, 52mg, tab.mifepristone 10mg, papain ip 521700, units, urea ip 100mg, ointment 1%w/w,, 100gms tube, paracetamol, suppositories 80mg, podophyllin resin 20%, tab.racecadotril 100mg, salcylic acid+lactic acid, oint 6% 30 gr, soda lime crystals 5kg, tins, sodium phosphate 10, gm enema pack 100ml, tab.cintapride 1mg, tab.methyl phenidate, hydrocloride 18mg, hydrocortisone acetate, 10% w/w oint 20.8 gm, barium sulphate, powder 1kg, tab.cepodoxime 500mg, tab.feropenam 200mg, inj.sugammadex 100, mg/5ml vial, inj terlipressin, 0.12mg/ml (1mg in, 8.5ml), tab.atamoxetin 10 mg, inj nicrondil 4mg, cardioplegia solution, 20ml inj, inj l ornithine l, apartate-5g/10ml, cap.valgancyclovir, cap.l-ornithine, l-aspartate, silymarin, grap seed extract,, nicotinamide capsule, 150mg:70mg, warfarin sodium tablets, ip 3 mg, cap.levosalbutamol, respule 0.63mg/3ml, non-ionic, contrast-gadotridol, 0.5m 10ml/15ml, non-ionic, contrast-iomeprol, 400mg 50ml/100ml, oral contrast-sodium, diatrizoate 25%, 30ml/100ml, tab.morphine sulphate, 10mg, ethamsylate injection, 125mg/ml 2 ml ampoule, nitroglycerine (n.t.g.), injection 5mg/ml in 5 ml, octreotide injection, 100mcg/ml, carbimazole tablet, 10mg, cefixime tablets ip 200, mg, paclitaxel injection ip 30, mg / 5 ml, carboplatin 450mg / 45, ml injection vial, amoxicillin capsules ip, 500 mg, azithromycin tablets ip, 500 mg, antisnake venom, injection, isosorbide dinitrate, tablets 10mg, carbimazole tablets, 20mg, quetiapine 25mg tablet, ketorolac tromethamine, injection 30mg /ml, 1 ml, ampoule, furosemide tablets ip, 40mg, olanzapine tablets 5 mg, natamycin eye drops, 5%w/v, escitalopram tablets, 5mg, pregabalin sr tablet, 75mg, furosemide injection , ip, 10mg/1ml in 2 ml amp, dobutamine hcl for, injection usp 250mg /, 20 ml vial, tab.entecavir 1mg

CTN :39920812

25 Apr, 2025 NA

Pune - Maharashtra

Tender For supply of phenol red , ph strip , turbidity transparency tube , hexamethylenetetramine 99 extra pure , hydrazine sulphate 99 ar acs , potassium chloride 99 extra pure , ethylenediamine tetraacetic acid disodium salt 99 ar acs , eriochrome black t aracs , ammonia solution 30 ar acs , ammonium acetate 98 molecular biology , silver nitrate 99 9 ar acs , potassium chromate 99 5 ar , griess reagent kit , n 1 naphthyl ethylene diamine dihydrochloride 98 ar acs , sulphanilic acid 99 ar acs , orthophosphoric acid 85 for hplc , sodium nitrite 98 ar acs , cadmium metal granular 99 9 ar , zinc metal granular 99 5 extra pure , potassium nitrite crystals 96 ar acs , o tolidine 98 ar , alizarine ar , sodium fluoride 99 ar , zirconium oxychloride octahydrate 99 ar , spadns ar , sodium arsenite 98 ar , hydrochloric acid 37 acipur , 1 10 phenanthroline hydrochloride monohydrate 99.5 ar , hydroxylamine hydrochloride 99 ar acs , acetic acid glacial 99 7 ar , ammonium acetate 99 for hplc , sodium acetate anhydrous 99 ar acs , ammonium ferrous sulphate hexahydrate 99 ar acs , arsenic trioxide 99 ar , mercuric bromide 99 ar acs , zinc dust 95 extra pure , sodium hydroxide pellets 98 ar , mercuric bromide strips , cupric chloride dihydrate 99 ar acs , dithizone 98 ar , chloroform 99 8 ar , sodium sulphite anhydrous 98 ar acs , lead acetate trihydrate 99 ar acs , chloramine t trihydrate 99 ar , pyridine 99 5 ar , barbituric acid 99 ar , potassium cyanide 97 ar , picric acid 99 8 ar , sodium carbonate anhydrous 99 5 extra , sodium dihydrogen orthophosphate dihydrate 99 ar , water sample analysis , macconkey broth double strength , macconkey agar , durhams tube

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Hexamethylenetetramine Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector