Latest hysterectomy set Tenders | Government hysterectomy set Tenders

CTN :42174021

31 Oct, 2025 NA

Kannur - Kerala

Tender For bid to ras supply of lab items d d - kit for estimation of hdl cholesterol kit of 02 x 50 ml of erba , kits for estimation of cholestrol kit of 05 x 20 ml erba , kits for estimation of glucose kit of 02 x 200 ml erba , kits for estimation of urea kit of 05 x 20 ml of erba , kits for estimation of uric acid kit of 05 x 20 ml of erba , kits for estimation of creatinine kit of 04 x 60 ml of erba , kits for estimation of alkaline phosphatase kit of 06 x 06 ml of erba , kits for estimation of sgot ast kit of 05 x 20 ml of erba , kits for estimation of sgpt alt kit of 05 x 20 ml of erba , kit for triglyceride estimation kit of 05 x 20 ml of erba , kit for estimation of bilirubin kit of 04 x 60 ml of erba , diluent for auto haematology analyser erba h 560 , lyse 1 for auto haematology analyser bott of 200 ml erba h 560 , lyse 2 for auto haematology analyser bott of 500 ml erba h 560 , kit for estimation of hba1c kit of 2 x 15 ml erba , erba wash kit 4x50 ml , solution pack kit easy lyte and elctrolyte analyser 800 ml , kit for estimation of total protein kit of 5 x 50 ml of erba , pm kit for chem 5 plus v2 of erba , erba elite h clean for auto haematology analyser bott of 50 ml , diluent for auto haematology analyser erba h 360 , lyse for auto haematology analyser bott of 500 ml erba h360 , kit for estimation of albumin kit of 5 x 50 ml of erba , kit for estimation of calcium kit of 2 x 50 ml of erba , estimation of ldl cholesterol of erba of 2x10 ml , estimation of vldl cholesterol of erba ) /bid number : gem/2025/b/6717652 * /dated: 07-10-2025 & & / bid document 1 / 25

State Government

CTN :42331472

13 Nov, 2025 2.27 Crore

Vadodara - Gujarat

Tender For corrigendum : supply of ferritin , d dimer , acid alkaline wash , plasma glucose estimation kit based on god pod enzymatic end point method , plasma glucose estimation kit based on hexokinase , serum urea estimation kit based on gldh enzymatic uv kinetic method , serum urea estimation kit based on modified berthelot method , serum total cholesterol estimation kit based on chod pod , serum creatinine estimation kit based on jaffe s method 2-point rate reaction , serum creatinine estimation kit based on enzymatic method , serum total protein estimation kit based on biuret method , serum albumin estimation kit colorimetric bcg method , serum total and direct bilirubin estimation kit jendrassik and grof method , serum total bilirubin estimation kit for fully automated , serum direct bilirubin estimation kit for fully automated , serum alp alkaline phosphatase estimation kit ifcc optimised kinetic method , serum alp alkaline phosphatase estimation kit dea diethanolamine buffer , serum sgot estimation kit based on ifcc optimised kinetic method , serum sgpt estimation kit based on ifcc optimised kinetic method , serum ck mb estimation kit based on ifcc kinetic method immunoinhibition , serum total ck estimation kit based on ifcc uv kinetic method , serum ldh estimation kit based on ifcc kinetic method , serum ggt estimation kit based on ifcc kinetic method , serum hdl estimation kit direct method , serum ldl estimation kit direct method , serum triglyceride estimation kit based on gpo pap enzymatic method , serum total calcium estimation kit based on arsenazo iii method , calcium ocpc estimation kit , serum phosphorus estimation kit based on phospho molybdate , serum magnesium estimation kit based on xylidyl blue colorimetric end point , serum alpha a amylase ) /bid number : gem/2025/b/6790708 * /dated: 16-10-2025 & & / bid document 1 / 64 estimation kit based on enzymatic kinetic ifcc method , serum lipase estimation kit based on enzymatic kinetic ifcc method , serum uric acid estimation kit based on uricase pod end point method , micro protein estimation kit , serum total iron estimation kit based on ferrozine colorimetric end point method , quality control serum level 1 and 2 , multicalibrator sera for clinical chemistry assays cal 2 , multicalibrator sera for clinical chemistry assays cal 3 , c reactive protein control kit , cholinesterase estimation kit , immunoturbidi metric kit for hba1c , hba1c control set kit , rapid troponin i card test , homocysteine estimation kit , lipoprotein a estimation kit , ada estimation kit , lipoprotein b estimation kit , serum total and direct bilirubin enzymatic kit estimation kit , probe cleanser , pro clacitonin estimation kit , il 6 estimation kit , d dimer estimation kit , vitamin b12 estimation kit , troponin i and t quanitative estimation kit , beta hcg estimation kit , beta 2 microglobulin estimation kit , estradiol estimation kit , progesterone estimation kit , prolactin estimation kit , amh , testosterone estimation kit , c peptide estimation kit , cortisol estimation kit , insulin estimation kit , pth estimation kit , vitamin d3 estimation kit , tsh , thyroxin , free t3 estimation kit , anti tpo estimation kit , psa total estimation kit , psa free estimation kit , fsh , leutanizing hormone , ca 15 3 estimation kit , ca 19 9 estimation kit , cea estimation kit , ca 125 estimation kit , afp estimation kit , concentrated wash buffer , pretrigger , trigger , reaction vessels , tumor marker tri level compatible for fully auto chemileuminesence analyzer , immuno assay controls tri level compatible , probe conditionig solution , septum , pm kit //bid details 2 / 64

CTN :42294669

30 Oct, 2025 NA

Dimapur - Nagaland

Tender For corrigendum : supply of kit of estimation of albumin 50ml bott 1box aspen company , antistreptolysin o test latex agglutination principle, complete with control serum aso , kits for estimation of alkaline phosphatase 5 x 20 ml erba , kit for estimation of bilirubin 2 x 60 ml erba , kits for estimation of creatinine 2 x 60 ml erba , kits for estimation cholesterol 5 x30 ml erba , liq glycerine , kits for estimation of glucose 200ml bott 1box aspen company , hiv i and ii rapid test kit of 10 test , hcv rapid card kit , kit for estimation of hdl cholesterol kit of 50 tests , leishman stain ready to use 1 x 500ml , paracheck test for malaria pv and pf , microtips in closed box of 96 tips 5ul to 200 ul, pack of 960 tips , microtips in closed box of 96 tips 100 ul to 1000 ul pack of 960 tips , pregnancy test card , kits for estimation of sgot ast 5 x 20 ml erba , kits for estimation of sgpt alt 5 x 20 ml erba , total protein test kit , kit for triglyceride estimation 1x50ml , kits for estimation of urea 5 x 20 ml erba , kits for estimation of uric acid 5 x 20 ml erba , keto diastix bott of 50 strips , blood group a b ab d reagent 10 ml each for a b o x 1box , dengue rapid test ns ag igm plus igs combo pack for 10 test , vaccum blood collection tubes with flash backe nedles edta 2ml 3ml , hydrochloric acid soln , ra factor rf latex kit 25 test , sterile urine container 50 ml pkt of 100 bott , vdrl test card kit of 10 test , wbc diluting fluid bott , disposal esr test tube , rapid card screening for hbv , rbc diluting fluide , red vial , kit for scrub typhus test , spirit 500ml , widal test kit 4x5 , disposable glucometer lancet for finger prick pkt of 100 ) /bid number : gem/2025/b/6772889 * /dated: 14-10-2025 & & / bid document 1 / 32

State Government

CTN :42402917

08 Nov, 2025 25.00 Lacs

Himatnagar - Gujarat

Tender For supply of laproscopic monopolar,laproscopic monopolar,laproscopic bipolar,laproscopic bipolar,laproscopic sukhadia,laproscopic trocar,laproscopic,laproscopic,laproscopic,laproscopic,laproscopic,laproscopic,sims vaginal speculums,sims vaginal speculums,sims vaginal speculums,abdominal hysterectomy set,vaginal hysterectomy set,myomectomy clamp,doyen myoma scew,d and c set sims speculum,iucd removal hook,cervical biopsy forcep,uterine packing forceps,vulsellum forceps,vulsellum forceps,sponge holding,spencer-wells artery forceps,spencer-wells artery forceps,tissue forceps,tissue forceps,mtp set sims speculum,modular suction,tissue forceps,needle holder,needle holder,scissors,scissors,scissors,ovum forceps,ovum forceps,ovum forceps,intestinal clamp,hysterectomyclamp,retractor hand,retractor hand,uterinedilators,sargent retractor,suture removal scissor,scissors episiotomy,dissecting forceps,dissecting forceps,dissecting forceps,dissecting forceps,blade handles,karman cannula set,stainless steel tray,stainless steel tray,sta

CTN :42291798

04 Nov, 2025 NA

Lucknow - Uttar Pradesh

Tender For supply of vaginal hysterectomy set for the department of obstetrics & gynaecology

CTN :42305533

05 Nov, 2025 NA

Jammu - Jammu And Kashmir

Tender For supply of tab abiraterone 500mg , tab acalabrutinib 100mg , tab azathioprine 100 mg , buprenorphine patch 20 mcg buvalor , tab cabozatinib 20mg , tab carbamazepine cr 300mg , carbidopa 10 mg plus levodopa 100 mg cr tab , carbidopa 25mg plus levodopa 100 mg cr tab , cervical collar soft size l , cyclosporine a micro emulsion 100mg ml bottle of 50ml , desmopression nasal spray 100ug ml bott of 5ml , diazepam 5 mg tab , haloperidol deconate inj 50 mg ml , dextrose 5 percentage inj , kit for estimation of cholesterol 5x20ml , kit for estimation hdl cholesterol kit of 100 ml , test for estimation of triglyceride 5x20ml , kit for estimation of uric acid 5x20ml , l ornithine l asparate powder 5gm , tab lenvatinib 10mg , beclomethasone diproprionate 50 mcg and levosalbutamol 50mcg per metred dose in cfc free mdi aerocort , paraffin liquid bott of 100ml , memantine 5mg tab , mesalamine sachet 1000mg , mesalamine 400 mg tab , methotrexate 15mg tab , methotrexate 5 mg tab , metoprolol sr 25 mg tab , tab carbimazole 10 mg , novelon tab ethinyl estradiol 0 point 03mg plus desogestrel 0 point 15mg , pantoprazole 40mg plus domperidone 10 mg tab , pantoprazole 40mg plus domperidone 30mg sr tab , oint povidone iodine 10 percentage w w tube of 15gm , pramipexole 0 point 25 mg tab , prasugrel 10mg tab , prochlorperazine maleate 5mg tab , rabeprazole 20mg tab , rifampicin cap 150mg , rifampicin 450mg cap , rifampicin 600mg plus isoniazid 300mg tab , rotacap fluticasone 100 mcg plus salmetrol 50mcg , salbutamol asthalin rotacap 200 mcg , salicylic acid 12 percentage oint , silver nitrate plus chlorhexidine oint burnheal , tab sotalol 40mg , syp iron with with vit b12 and folic acid bott of 200 ml , tab torsemide 40mg , tranexamic 500mg plus mefanamic 250 mg tab , kits for estimation of urea 100 ml , ursodeoxycholic acid 300mg tab , vacutainer needle , tab venetoclax 100mg , vericiguat 2 point 5 mg tab , xylometazoline hcl 0 point 05 percentage w v nasal solution bott of 10ml , novopen needle all size pen needle , cap acebrophylline 100mg , tab ambrisentan 5 mg , amlodipine besylate 10 mg tab , amoxycillin 125 mg dispersible tab , bandage triangular , tab betahistine dihydrochloride 16mg , betamethasone valerate 0 point 1 percentage oint tube 20 gm betamethasone valerate 0 point 1 percentage , budesonide 200 mcg dry powder , silodosin 8mg plus dutasteride 0 point 5mg tab , tab carbamazepine 100 mg , cefpodoxime 200 mg plus clavulanic acid 125 mg tab , chlordiazepoxide 5mg plus clinidium 2 point 5mg tab , enteral feed powder protein 85 percentage short chain peptides 15 percentage free amino acids fat 50 percentage mct 25 percentage vet fat carbohydrate malto destri sachet of 126 gm , nepafenac 0 point 3 percentage eye drop 5ml //bid details 2 / 57

State Government

CTN :42267843

03 Nov, 2025 2.50 Lacs

Delhi - Delhi

Tender For supply of bakers yeast , sodium pyruvate , sucrose , tris , bsa , mgcl2 , naoh , agar , ether , cotton , rna isolation kit , diethylpyrocarbonate depc , dual luciferase reporter assay kit , glacial acetic acid , acetone , catechol , bromine , carbon tetrachloride , stoppered conical flask 250 ml , rnaase inhibitor , dnaase , tlc plates , tlc chamber glass , amino acids reference standard kit , tris-hcl , methanol , standard protein marker broad range , butanol , petroleum ether , nh4cl , hcl , ficoll hypaque density gradient media , nahco3 , ethanol , beetroot borer , pcr teaching kit , southern blotting kit , diastase , cholestrol estimation kit , lb agar , penicillin , grams iodine , widal test kit , 3,5- dintrosalicyclic acid , mtt , passive agglutination , double immunodiffusion , single radial immunodiffusion , dot blot elisa , t 4 estmation kit , estmation of urea , estmation of uric acid , sgot and sgpt , serum creatinine. , restriction digestion kit , competent cells preparation kit , blue white screening transformation kit , nickel affinity chromatography kit , microtips 100-1000ul , microtips 2- 200ul , teepol , tissue roll , glass cuvette 3.5ml , glass cuvette 1ml , quartz cuvette 1ml , measuring glass cylinders 100ml , glass pipettes 1ml , glass pipettes 2ml , glass pipettes 5ml , glass pipettes 10ml , falcon tubes 15ml , beakers 100ml , beakers 250ml , beakers 500ml , beakers 1000ml , mannitol salt agar , emb agar , macconkey agar , bacterial identification kit himedia kb016 , bacterial identification kit himedia kb013 , bacterial identification kit himedia kb004 , chloroform , china dish , glass beads small

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Hysterectomy Set Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

State Government

Central Government/Public Sector