Latest lamivudine tablet lamivudine zidovudine tablet Tenders | Government lamivudine tablet lamivudine zidovudine tablet Tenders

CTN :39466581

14 Apr, 2025 50.00 Lacs

Jamnagar - Gujarat

Tender For bid to ras supply of modern medicines - polygeline 3.5 gm plus potassium chloride 38 mg plus sodium chloride 850 mg , inj. carboprost-tromethamine , inj. thiopentone , inj. pilocarpine 2 percentage w v , inj. ceftriaxone- 1 gm , inj. noradrenaline , inj. etophylline plus theophylline , inj. vitamin k 0.5 ml , inj. paracetamol , inj. lodized vitamin a,d,e and biotin , inj. cefoperazone and sulbactum 1.5 gm , inj. lignocaine 2 percentage , cap. nifedipin 10 mg , tab. ondansetron sublingual , cap. cyanocobalamin 15 mcg plus ferrous fumarate 300 mg plus folic acid 1.5 mg , tab. tramadol hydrochloride 37.5 mg plus acetaminophen , tab. aceclofenac 100 mg plus paracetamol 325 mg plus serratiopeptidase 15 mg , tab. ibuprofen 400 mg plus paracetamol 325 mg , tab. paracetamol 650 mg , cap. rabeprazole 20 mg plus domperidone 30 mg , tab. cefixime 200 mg , tab. linezolid 600 mg , tab. levocetirizine 5 mg , tab. moxifloxacin 400 mg , tab. levofloxacin 500 mg , cap. cefdinir 300 mg , cap. pantoprazole 40 mg plus domperidone 30 mg , tab. pantoprazole 40 mg , tab. amoxycillin plus clavulanic acid 625 mg , tab. vitamin b complex plus biotin plus vitamin c , cap. nifedipine , tab. meclizine hydrochloride 25 mg , tab. ethamsylate 500 mg , tab. misoprostol 25 mcg , tab. misoprostol 200 mcg , tab. labetalol hydrochloride 100 mg , tab. dicyclomine 10 mg plus mefenamic acid 250 mg , tab. drotaverine hydrochloride 40 mg , tab. isoxsuprine 40 mg , tab. nitrofurantoin 100 mg , tab. glyceryl trinitrate 0.5 mg , tab. isosorbide mononitrate 10 mg , tab. ofloxacin 200 mg plus ornidazole 500 mg , tab. metronidazole 200 mg , tab. ofloxacin 200 mg , tab. cetrizine 10 mg , tab. metronidazole 400 mg , tab.vertin 16 mg , silver nitrate gel , povidine iodine solution , lignocaine hydrochloride jelly , dinoprostone gel 0.5 mg , povidine ointment, 50 gm , hemocoagulase 0.2 cu , hydrogen peroxide , diatrizoic acid - 76 percentage , formaldehyde , tab. formalin , chloramphenicol 10 mg plus dexamethasone 1 mg plus polymyxin b 10000 i.u. , ciprofloxacin 0.3 percentage w w , povidine lodine ointment , cyclopentolate 1 percentage w v , proparacaine na 0.5 percentage , flurbiprofen 0.03 percentage w v hydroxypropyl methylcellulose 0.25percentage w v phenyl mercuric nitrate 0.002 percentage w v , moxifloxacin 0.5 percentage w v , timolol 5 mg plus brimonidine 2 mg , moxifloxacin 0.5 percentage plus dexamethasone 0.1 percentage plus hydroxypropyle methylcellulose 0.25 percentage , phenylphrine 5 percentage w v plus tropicamide 0.8 percentage w v , tropicamide 1 percentage w v , pilocarpine 2 percentage w v , xylometazoline 0.1 percentage , carboxy methylcellulose 0.5 percentage w v , homatropine hydrobromide , lidocaine 10 percentage , oxymetazoline hydrochloride usp , hydroxypropyl methylcellulose 2 percentage w v , sodium chloride 0.9 percentage w v , diclofenac suppository , liquid paraffin , liquid glycerine , sodium phosphate enema , glutaraldehyde , povidone iodine powder 5 percentage w w , magnesium suphate powder , syrup cetrizine , syrup ondansetron , syrup salbutamol , syrup hyoscine butyl bromide , lactic acid bacillus earlier known as lactobacillus sporogenes , ors sachet , midazolam nasal spray 0.5 mg , salbutamol respirator solution 2.5 mg , paracetamol paediatric oral suspension 125 mg , paracetamol paediatric oral suspension 100mg

Central Government/Public Sector

CTN :39774693

15 Apr, 2025 NA

Kanchipuram - Tamil Nadu

Tender For corrigendum : supply of items for protein studies - ml040 to 500ml 5x tris sds buffer ph 500ml , ml039 to 500ml 2.5 x tris sds buffer ph 500ml , 10x tris glycine sds gel running buffer , acrylamide bisacrylamide solution 30 percent , prestainer protein ladder 10ln , bradford reagent 500ml , tris free base 500gm hhimedia , grm6365 to 500g di sodium hydrogen phosphate dihydrate , potassium dihydrogen , ml016 to 500ml 50 xtae used for gel electrophoresis , ml013 to 500ml to 1m tris cl ph 8 , ml123 to 1ktsilver staining kit , lysozyme 5gm , cms1889 to 1grifampicin 1gm , ammonium sulphate 500 gm , dodecyl sulphate sodium salt for mb 25gm , parafilm m 2 x 250 1pk roll , silver sulphate hi lr 25gm , albumin bovine fraction v 5gm , sd028-1vl penicillin g p 10units , storage vials pp 10ml sterile 300 pk pack tarson , glutaraldehyde solution 25 percent 25ml

CTN :39807687

17 Apr, 2025 NA

Anantnag - Jammu And Kashmir

Tender For corrigendum : e.nit no 03 gmca of 2025 for reagents, drugs and medical consumables - tender for reagents, drugs and disposables., inj. cefuroxime 1.5 g, inj.clindamycin 600 mg, inj.succinylcholine 50mg/ml, inj.vasopressin, inj.physostigmine, inj.anti rabies serum, inj.anti rabies vaccine, inj. piperacillin tazobactum 2.25 gm, inj.isoprenaline 2mg/ml, inj. dextrose normal saline 500 ml, inj. normal saline 500 ml, inj.iron sucrose, inj. tetanus toxoid, inj. diltiazem 5mg, inj.streptokinase, inj.tenectapilase, inj. vitamin k, inj. infusion haemaccel 500 ml, inj. teicoplanin, inj. methyl prednisolone 125 mg, inj. methyl prednisolone 500 mg, inj.xylocard 2%, inj. digoxin, inj.heparin 25000iu, inj.insulin 30/70, inj. haemaccel (3.5% colloidal infusion solution ) 500 ml, inj. biphasic insulin 30/70 40iu, inj.dextrose 5%, inj.paracetamol infusion 100 ml, inj.teicoplanin, iv fluid set, dispo syringe 5ml, dispo syringe 3 ml, dispo syringe insulin 31 g, angiocath 24 g/18 g, urine collection bag adult, glucometer strips along with meter, absorbant cotton 500 gm, gauze cloth than, sodium hypochlorite 5% and 10 %, av tubing blood lines, av fistula needles 16/17 g, citrosterile disinfectant 5 ltr can, diasafe plus filter, haemobicarb part a+part b, introducer needles, disposable pressure transducer, transducer protector, hollow fiber dialyzer, femoral catheter 14cm*14cm, ecg paper 210mm 20 mtr (ecg 9108 z-fold paper), antisera d 10 ml, widal kit, crp omega kit, aso kit, distilled water can 5 ltr, erba diluent h560, erba lyse -i h560, erba lyse -ii h560, glutaraldehyde solution(cidex) 5ltr, hiv elisa, dispo shoe cover, dispo blanket cover, dispo gown, ahg gel cards -matrix, abo gel cards -matrix, lyss -matrix 250ml, ahg coombs sera 5 ml, antisera abd 10 ml (tulip), anti sera ab 10 ml, anti sera a1 5 ml, pipette multi channel 10-100 micro litre, pipette multi channel 100-1000 micro litre, formalin liquid 5 ltr, hydrophilic foldable lens a/s, hydrophobic foldable lens a/s, rigid lens a/s, iris claw lens a/s, glass slides 75*25 mm 1*50, inj.erythropoitin 10000iu pfs, inj carboprostate tromethamine 250 mcg, inj etomidate, inj glycine 3000ml, inj valthamate bromide, macintosh apparan, mersilk (1) 5062, dispo molin sheets, monocryl (3-0), nasal oxygen set paediatric/ neonate/ adult, sr. blood urea (tulip/ranbaxy/meril/span), antisera-d 10ml (tulip), sr. albumin (tulip/ranbaxy/meril/span), sr. alkaline phosphate (tulip/ranbaxy/meril/span), sr. calcium (tulip/ranbaxy/meril/span), sr. creatinine (tulip/ranbaxy/meril/span), sr. phosphorous (tulip/ranbaxy/meril/span), sr. sgot (tulip/ranbaxy/meril/span), sr. sgpt (tulip/ranbaxy/meril/span), sr. total protein (tulip/ranbaxy/meril/span), stromatolyzer 500ml reagent for sysmex machine, cell pack 20 liter reagent for sysmex machine, tablet misoprostol 200mg, umbilical card clamp, usg paper type-v (sony), dynoprostone gel, iv set/ drip set, cautery pencil, ctg paper 151mm*90mm*150 sheets (bristal indian), phenyl black 5liter, cell clean 5ml sysmex, cell cleaner erba 5ml, qc erba high/low/normal, qc sysmex high/low/normal

Central Government/Public Sector

CTN :39949431

16 Apr, 2025 NA

Multi City - Multi State

Tender For supply of solution glutaraldehyde solution 2% -1000 ml

CTN :39881293

22 Apr, 2025 9.49 Lacs

Darjeeling - West Bengal

Tender For supply of d ifa re 13 decapeptide 10mg lot 10ml bott , d ifa re 13 diphtheria tetanus acellular pertussisdtap single dose vaccine , d ifa re 13 inj gadobutrol 1dot0mmolml 10ml vial , d ifa re 13 umbilical catheter 3dot5 fr , d ifa re 13 tracheostomy tube 8mm with cuff and two inner cannula , d ifa re 13 sodium perborate monohydrate 50 ww solution parasafe , d ifa re 13 inj noval rabies monoclonal antibody containing docaravimav and miromavimab 1500iu2dot5ml , d ifa re 13 locking reconstruction plate 3dot5mm titanium 14 hole with twelve 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 10 hole with ten 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 12 hole with twelve 3dot5mm locking head screws , d ifa re 13 neonatal central venous triple lumen catheter central line size2dot5fr , d ifa re 13 cpap disposable tubing with water chamber and humidifier chamber , d ifa re 13 bipolar marryland vessel sealer 5mm , d ifa re 13 neonatal central venous triple lumen catheter central line size3dot0fr , d ifa re 13 endopath endoscopic bowl clamp with ratchet , d ifa re 13 disposable perforator for craniotomy atraumatic tip 14mm , d ifa re 13 thalidomide 100mg cap , d ifa re 13 antimicrobial skin cleaning wipes polyhexanide based pack of 1012 wipes , d ifa re 13 vitb complex forte with ascorbic acid cap , d ifa re 13 cyclosporine 50mg tabcap , d ifa re 13 thiocolchicoside 4mg captab , d ifa re 13 vit d3 100 iu folic acid 1mg mayoinositol 2000mg sachet5 gm each pack of 30 , d ifa re 13 glycolic acid 6 cream 30 gm tube , d ifa re 13 octinoxateniacinamideglycolic acid 3kojic acid dipalmitatearbutinmulberry extract1 tocopheryl acetateallantoinlicoric extract tetrahydrocurcumin30gm , d ifa re 13 crystal trichloroacitic acid 100 , d ifa re 13 gel sunscreen gel spf40 60gmoctinoxatediethylamino hydrobenzoyl hexyl benzoatebisethyloxyphenol methoxyphenyl microfine , d ifa re 13 hair rremoval contains watermineral full nomenclature in pdf format , d ifa re 13 hand disinfectant 32dot5 gm propanolol1 18 gm etahol 0dot1 gm glutaraldehyde bott of 250 ml liq , d ifa re 13 liquid disinfectant each 05 lit contains sodium chloride 605 gm potassium chloride 10 gm sod bi carbonate 15 gm in buffer solution qs and stabilizer qs can of 5 ltrsterisol , d ifa re 13 betamethasone 0dot05 zinc sulfate 0dot5 lotion 50ml bott , d ifa re 13 desonide 0dot05 ww gel 20gm , d ifa re 13 paracetamol 500mg caffeine 65mg tab , d ifa re 13 neomycin pulv bott 5 gm , d ifa re 13 serum vit k under eye serum 30 ml , d ifa re 13 ketoconazole ichthyal pale dpanthenol alovera 10 75ml shampoo , d ifa re 13 diazepam suppository , d ifa re 13 paracetamol 250mg suppository , d ifa re 13 surgical scrub 2 chlorhexidine in 70 ethyl alcohol without any moisturizers bott of 500 ml , d ifa re 13 cefpodoxime oral suspension , d ifa re 13 ofloxacin orinidazole syp 30 ml bottle , d ifa re 13 oseltamivir 12mgml syp , d ifa re 13 alfuzocin 10mg dutasteride 0dot5mg tab , d ifa re 13 amoxycillin 250mg clavulanic acid 50mg tab , d ifa re 13 calcium carbonate 250 tab , d ifa re 13 itopride 100mg tab , d ifa re 13 chlordiazepoxide 5mg clinidium 2dot5mg tab , d ifa re 13 mesalamine 200mg tab , d ifa re 13 metalozone 5mg tab , d ifa re 13 montelukast 10mg tab bid details/ 2 / 46

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

Lamivudine Tablet Lamivudine Zidovudine Tablet Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

corporations/Associations/Others