Ms Ladder Repair Tenders

Get complete information related to latest Ms Ladder Repair Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Ms Ladder Repair Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Ms Ladder Repair Tenders .

Filter

Loading....

Get Tender in Email

CTN :41802721

22 Oct, 2025 NA

Delhi - Delhi

Tender For bid to ras bid to ras supply of integrated tunnel defence d d - construction of internal tunnel defence , rcc work , over head protection , loop hole , electrical portion , cement opc 53 grade , natural sand conforming to is 383 1970 , stone aggregate 40 mm , stone aggregate 20 mm , aac blockes , tmt steel bar , shuttering plywood , woodn ballies , wooden scantling , binding wire , nails 2 inch , nails 3 inch , nails 4 inch , j hook 8 mm dia , ms angle , pbs roll , ldpe sheet , hdpe laminated sand bag , prefabricated mild steel door , synthetic enamel paint , lime for white wash , ms loop hole , ms shuttering plate , steel roofing trough , ms angle 65 x 65 x 6 mm , water proofing compound , quick setting compound , pvc casing capping 32 x 16 mm , 05 amp modular switch , decorative ultra slim linear led lighting , 05 amp modular switch and socket combination , pvc frls insulated , ceiling rose , modular pvc switch , screw 1 oblique 2 inch star type , concrete mixer , portable ms body needdle vibrator machine , rechargable drill machine , measuring tape 5 mtr , measuring tape 15 mtr , measuring tape 30 mtr , mason trowel 125mm , mason trowel 150 mm , mason trowel 200 mm , steel bucket of 15 ltrs capacity , spanner set , clay hammer , phawrah , cutting plier , hecksaw blade , tube level pipe 4mm of 15mtr length , hand gloves for mason , industrial safety helmet ratchet , trowel with wooden handle isi marked , fish line best quality , plumb bob iron best quality. , galvanised iron pan mortar , rammer earth with handle , picks axes , round nose shovel hand , crow bar 1550 mm , snow goggles , painting brush 100 mm best quality , brick trowel steel , hand held portable drill machine , portable generator set 5 kva , gum boot , hdpe water tank 500 ltrs , self supporting aluminium step ladder 6 ft height , multi layer composite gate valve 25mm , multi layer composite tank connector , 5 hp pump valve spring 6 nos per set , multi layer composite flexible pipe , multi layer composite socket , multi layer composite t , multi layer composite bend , multi layer composite union , high head water pump 5 hp

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Loading, Please wait...

Ms Ladder Repair Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector