Web Analytics Made Easy - StatCounter

Multiplex Assay Kits Tenders

Get complete information related to latest Multiplex Assay Kits Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Multiplex Assay Kits Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Multiplex Assay Kits Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :42429620 Due date: 17 Nov, 202517 Nov, 2025 NA
Tender For two year rate contract for supply of diagnostic test kit for serology laboratory (4th call) for microbiology department at all india institute of medical sciences, raipur.

CTN :42291164 Due date: 07 Nov, 202507 Nov, 2025 NA
Tender For supply and installation of laminar air flow machine (2 feet vertical) for use in the viral research and diagnostic laboratory (vrdl)

CTN :42293015 Due date: 28 Oct, 202528 Oct, 2025 5.25 Lacs
Tender For equipment for virus research and diagnostic laboratory (civil work) - dept of vrdl, vertical autoclave (100ltr), vertical pharmaceutical refrigerator (2-8 0 c), temperature and humidity monitor for laboratory, temperature data logger for refrigerators

CTN :42373345 Due date: 30 Oct, 202530 Oct, 2025 NA
Tender For supply of essential drugs, consumable items, diagnostic kits, laboratory reagents and chemicals

CTN :42190274 Due date: 23 Oct, 202523 Oct, 2025 NA
Tender For supply of medical text books d d - orthopaedics examination , clinical orthopaedic diagnosis , step by step management of clubfoot by ponseti technique , the element of fracture fixation , post graduate pharmacology , essentials of medical pharmacology , principles of phamacology , handbook of experimental pharmacology , fundamentals of experimental pharmacology , pharmacology and pharmacotherapeutics , chaurasia practical pharmacology , essentials of biostatistics and research methodology , competency based practical pharmacology , postgraduate topics in pharmacology , essential of postgraduate pharmacology and biostatistics , oxford handbook of tropical medicine , mahajans methods in biostatistics , essentials of biostatistics research methodology , gordis epidemiology , strengths based leadership , student engagement techniques a handbook for college faculty , mxey rosenua lst public health and preventive medicine , sociology basic concepts , sociology of health and medicine , nutrition child development , introduction to biostatistics and research methods , modern opthalmology vol 1 2 3 , clinical opthalmology for post graduates vol 1 2 3 , walsh and hoyts clinical neuro opthalmology , opthalmological surgical instruments , color atlas and synopsis of clinical opthalmology wills eye institute pediatric opthalmology , stabisums simplified , aravind faqs in opthalmology , bailly scotts diagnostic microbiology , larones medically important fungi , jawetz melnick adelbergs medical microbiology , roitts essential immunology , clinical periodontology and implant dentistry , carranzas clinical periodontology , scullys oral and maxillofacial medicine the basis of diagnosis and treatment , burketts oral medicine , monheims local anaesthesia and pain control in dental practice , mc donald and averys dentistry for the child and adolescent , pediatric dntistry infancy through adolescence , contemporary orthodontics , textbook of forensic odontology , petersons principles of oral maxillofacial surgery , handbook of local anasthesia , the extraction of teeth , medical emergency in the dental office , ten teachers obstetrics , ten teachers gynaecology , william obstetrics , william gynaecology , telindes operative gynaecology , basics of gynaecolog for examinee , management of labour , high risk pregnancy delivery , ian donalds practical obstetric problem , speroffs clinical gynaecologic endocrinology infertility , recent advances in obstetric and gynecology , john studds current progress in obstetric and gynecology vol7 , an introduction to male reproductive medicine , essentials obstetrics and gynaecology , beckmann and lings obstetrics gynaecology , dewhurts textbook of obstetrics gynaecology , oxford handbook of obstetric and gynaecology , munrokers operative obstetrics , atlas of pelvic anatomy and gynaecology surgery , shaws textbook of gynaecology , holland and brews manual of obstetrics , fertility control , texybook of obstetrics , textbook of gynaecology , ct and mri of the whole body 2 volume set , otorhinolaryngology head neck surgey , disease of the nose throat and ear head and neck surgery , surgery of the ear , head neck , endoscopic surgery , clinical audio vestibulometry for otologists and neurologists , the essentials of forensic medicine and toxicology , textbook of forensic medicine and toxicology , forensic medicine toxicology for medical students , parikhs textbook of medical jurisprudence forensic medicine and toxicology , modis textbook of medical jurisprudence and toxicology , knights forensic //bid details 2 / 94 pathology , handbook of forensic medicine , thieme test prep series forensic medicine toxicology , handbook of autopsy practice , orell and sterretts fine needle aspiration cytology , dacie and lewis practical hematology , principles and interpretation of laboratory techniques in pathology , pathologic basis of disease 2 volume , the bethesda for reporting cervical cytology , the bethesda system for rep

CTN :42179130 Due date: 17 Oct, 202517 Oct, 2025 NA
Tender For notice inviting expression of interest (eod) for empanelment for diagnostic services (laboratory & radiology)

CTN :41897678 Due date: 17 Oct, 202517 Oct, 2025 60.51 Lacs
Tender For supply of kfd rt-pcr reagents for virus diagnostic laboratory shimoga - beta actin qsy probe vic5tcaagatcattgctcctcctgagcgc3 50000picomoles, actin rp5gccgatccacacggagtact3 80000picomoles, actin fp5ggcacccagcacaatgaag3 80000picomoles, taqman fast virus 1 step master mix for qpcr catalog number 4444434 1 qty 200x5, taqman qsy probe-50nm kfdv ns5 probe 6fam atg gag agg agc gcc tga ccc g 22 bases catalog no 4482779 50000 picomoles, kfdv ns5 r1-tca tcc cca ctg acc agc at 20 bases catalog no 4304971 80000 picomoles, sequence detetction primer kfdv ns5f1 tgg aag cct ggc tga aag ag 20 bases 4304971 80000 picomoles
 Loading, Please wait...

Connect us via What's Up