Web Analytics Made Easy - StatCounter

Panametrics Tenders

Get complete information related to latest Panametrics Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Panametrics Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Panametrics Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :41819161 Due date: 11 Oct, 202511 Oct, 2025 29.77 Lacs
Tender For kfd rt-pct testing rna kits and consumables for virus diagnostic lanoratory shimoga for fy-2025-26 - rna extraction manual kit pack of 250 rxn for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96, 24 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for genetix biotech purifier ht 96 96 well for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,24 well well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,48 well to be filled with reagents in 96well plastic ware for vdl laboratory, automatic rna kit compitable for thermo scientific kingfisher flex 96,96 well to be filled with reagents for vdl laboratory, small safe skin purple nitrile gloves 12inch extended cuff pack of 50 aql 1.5 astm 6319 standard gauge thickness measurements mm mil middle finger .15 5.9,palm .12 4.7, cuff.09 3.5 pack of 50 for vdl laboratory, cryo box 100 places paper for vdl laboratory, digital thermometer ilr for vdl laboratory, digital thermometer deep freezer-20 for vdl laboratory, amber color screw capped eppendorf tubes 2ml pack of 500 for vdl laboratory, te 1x buffer ph 8.0 rnase free 500ml for vdl laboratory, kim wipes lint free tissue white colour 4.4 inch x 8.4 inch 280 sheets is 1 unit for vdl laboratory, ice packs gel 20gms pack for vdl laboratory, filter tips racked low retention autoclavable with aerosal filter,universal size compatible with all micropipettes, free of detectable dnase,rnase,human dna pcr,hydrophobic polyethylene filters 10ul pack of 96 x10 box for vdl laboratory, cryochill external thread vial self standing sterile 1.8 ml pack of 1000 for vdl laboratory, permanent autoclave-resistant labels for vdl laboratory, buoffant caps- head cap(pack of 100) for vdl laboratory, ziplocks covers 5x7 in kg for vdl laboratory, ziplocks covers 8x10 in kg for vdl laboratory, cutter (paper knife) for vdl laboratory, dust pan for vdl laboratory, three bucket mopping for vdl laboratory, wet mop for vdl laboratory, dry dust control mop for vdl laboratory, hypoclorite solution5% 5ltr for vdl laboratory, disinfectctant cleaner (lyzol type)5ltr for vdl laboratory

CTN :41897678 Due date: 17 Oct, 202517 Oct, 2025 60.51 Lacs
Tender For supply of kfd rt-pcr reagents for virus diagnostic laboratory shimoga - beta actin qsy probe vic5tcaagatcattgctcctcctgagcgc3 50000picomoles, actin rp5gccgatccacacggagtact3 80000picomoles, actin fp5ggcacccagcacaatgaag3 80000picomoles, taqman fast virus 1 step master mix for qpcr catalog number 4444434 1 qty 200x5, taqman qsy probe-50nm kfdv ns5 probe 6fam atg gag agg agc gcc tga ccc g 22 bases catalog no 4482779 50000 picomoles, kfdv ns5 r1-tca tcc cca ctg acc agc at 20 bases catalog no 4304971 80000 picomoles, sequence detetction primer kfdv ns5f1 tgg aag cct ggc tga aag ag 20 bases 4304971 80000 picomoles

Central Government/Public Sector

CTN :42022790 Due date: 07 Oct, 202507 Oct, 2025 40.00 Lacs
Tender For procurement of diagnostic kits biochemistry reagents-hematology and pathology kits and laboratory consumables

Central Government/Public Sector

CTN :41707108 Due date: 06 Oct, 202506 Oct, 2025 1.50 Crore
Tender For corrigendum : supply of establishment of viral research and diagnostic laboratory : : - micro centrifuge , gel documentation system , deep freezer -80 deg c , laboratory incubator , cenrifuge , elisa reader , elisa washer , bio safety cabinet , analytical balance , thermo shaker , deep freezer -20 deg c , laboratory refrigerator 4 deg c , horizontal electrophoresis unit with power supply unit , real time pcr , laboratory and office furniture , civil work , cmc 6th year , cmc 7th year , cmc 8th year , cmc 9th year , cmc 10th year

Central Government/Public Sector

CTN :41970463 Due date: 06 Oct, 202506 Oct, 2025 40.00 Lacs
Tender For procurement of diagnostic kits biochemistry reagents hematology and pathology kits and laboratory consumables

Central Government And Public Sector

CTN :41537107 Due date: 30 Sep, 202530 Sep, 2025 2.03 Crore
Tender For corrigendum : supply and installation of clinical diagnostic laboratory equipments, reagents, consumables, manpower etc on cost per reportable test to central diagnostic laboratory at medical college hospital, bmcrc, ballari
 Loading, Please wait...

Connect us via What's Up