Latest paraformaldehyde Tenders | Government paraformaldehyde Tenders

CTN :40004777

03 May, 2025 13.67 Lacs

Dibrugarh - Assam

Tender For supply of bott of 30 ml , cap fluoxetine hcl 20 mg , tab nor ethisterone 5mg , respules levosalbutamol sulphate 2.5 ml containing 1.25 mg , inj cefoperazone sodium 1gm sulbactum sodium 1gm , tab sulphamethoxazole 400 mg trimethoprim 80mg , inj nitroglycerine and glyceryltrinitrate 5 mg , injectable typhoid vaccine , tab l carnitine coenzyme q10 zinc lycopene and astaxanthin , syp terbutaline sulphate bromphexine hcl 4 mg guaphenesin 50 mg , powder dextrose monohydrate for oral use pkt of 100gm , povidone iodine 7.5 percent solution of 100ml , inj sodium bicarbonate 7.5 percent amp of 10 ml , drop vitamin d3 cholecalciferol ip 400iu drop of 15ml , syp levocetrizine dihydrochloride 25mg montelukast 4 mg bott of 60 ml , tab clindamycin clotrimazole tinidazole vaginal pessaries , tab oxybutanin 2.5mg , cap cyclosporine 250mg , prebiotic probiotic sachet , syp fungal diastase with carminatives vitazyme , syp metronidazole 200 mg per 5ml bott of 60 ml , tab cilnidipine 5 mg , tab cilnidipine 10 mg , tab cilnidipine 20 mg , syp zinc 20 mg per 5 ml bott of 100 ml , tab fluconazole 150mg azithromycin 1000mg secnidazole 1000mg fas kit , tab clomiphene citrate 25 mg , tab nifedipine retard 20 mg , inj alteplase 50mg , tab efavirenz 600 mg , tab tenofovir 300 mg lamivudine 300 mg dolutegravir 50 mg , tab 5 amino salicylic acid 1.2 gm mesacol , tab cabergoline 0.5mg , sodium chloride 3 percent bott of 100ml , inj dexmeditomedine 100 mcg , tab aspirin 75 mg , tab fexofenadine 120mg montelukast 10mg , tab clotrimazole vaginal pessary 100mg , diclofenac sodium suppository 100 mg , bisacodyl suppositories , paracetamol suppository , oint traclolimus 0.1 percent tube of 10gm , human diploid cell rabies vaccine , mva syringe set with cannula , troponium t test card kit , tab h pylori kit lansoprazole tinidazole clarithromycin , tab paraformaldehyde , inj etomidate 2 mg per ml 10 ml amp , levonorgestrel iud mirena , amniotony hook , tab metformin sr 500 mg glimepride 2mg voglibose 0.2mg tab tramadol hcl 50 mg , tab montelukast 10 mg levocetrizine 5mg , inj hydrocortisone sodium succininate 100 mg, tab diclofenac sodium 50mg paracetamol 325mg chlorzoxazone 500mg, respules budesonide 1mg, tab amitriptyline 25 mg, inj bupivacaine hcl inj 5mg per ml heavy amp of 4 ml, tab pyrazinamide 1500 mg , tab itraconazole 100mg, tab azathioprine 50mg , inj methyl prednisolone sodium succinate inj 1000mg, inj lignocaine hcl 2percent with adrenaline1 80000 of 30 ml, inj ondansetron 8mg , tab medroxy progesterone 10 mg, tab folic acid 5 mg, inj tranexamic acid 500 mg per 5ml, tab common cold cetrizine 5 mg paracetamol 500 mg pseudoephedrine 60 mg, tab naproxen 250mg, chlorhexidine mouthwash 0.2percent bott of 100 ml, oint framycetin sulphate cream bp 1percent 20 gm, oint mupirocin 2 percent tube of 5 gm, oint povidone iodine 10 percent, oint terbinafine 1percent tube of 10 gm, inj frusemide 20 mg in amp of 2 ml, inj lignocaine hcl solution 2 percent for iv vial of 50 ml, inj tenecteplase 40mg , inj octreotide inj 0.1mg per ml , tab antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg, tab trypsin with chymotrypsin, enema sodium phoshate ml 6 percent sod acid phoshate 16percent pack of 100ml , inj metoprolol 1 mg per ml amp of 5 ml, inj labetalol hcl 5 mg per 5 ml , tab thyroxine sodium 0.025 mg , tab thyroxine sodium 0.1mg , inj neostigmine 0.5 mg in 1 ml , tab natural micronised progesterone 100 mg , dinoprostone gel 0.5mg bid details/ 2 / 75

CTN :39986166

01 May, 2025 NA

Gaya - Bihar

Tender For supply of ketamine hcl 50 mg per ml 2 ml inj , vitamin b complex with a minimum concentration of vit b1 5mg vit b6 3mg and vit b12 5mcg therapeutic tab cap , diclofenac sr 100 mg tab , tab pramipexole 0 point 25 mg , povidone iodine solution 5 percent bottle of 100 ml , tab epleronone 25 mg , tab olanzapine 10mg , syp multivitamin drops with constituents having vit a vit b1 b2 b6 vit c vit d bottle of 15ml osages as per recommended daily allowances , tab rosuvastatin 20 mg , diclofenac diethylamine 2 point 32 percent spray for tofical use , inj phytomenadione vit k 1 mg per 0 point 5 ml , inj esmolol 100 mg 10ml , tab rabeprazole 20 mg , inj benzathine penicillin i p 600000 i u , tab trimetazidine mr 35 mg , tab etoricoxib 120 mg , tab indomethacin 75 mg sr tab , tab ketorolac 10mg tab , tab tramadol hcl 50 mg , succinylchloline chloride 50 mg per ml 2 ml inj , tab dexamethasone 0 point 5 mg , inj pralidoxine 500 mg per 20ml , tab clofazimine 100mg , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , tab trihexyphenidyl hcl 2 mg , tab ethamsylate 250mg , gamma benzene hexachloride 1 percent w by v cetrimide 0 point 1 percent w by v in alcoholic solution , ciprofloxacin hcl 0 point 3 perent plus dexamethasone 0 point 1 percent bott of 5ml , tab glyceryl trinitrate cr 2 point 6 mg , tab thyroxine sodium 75 mcg , tab voglibose 0 point 3 mg , tab digoxin 0 point 25 mg , tab clonidine 100mcg , bisoprolol 5 mg tab , human insulin analogue glargine inj 100 iu per ml recombinant dna origin 300 iu disposable pen with 5 needles per pen , tab nebivolol 50 mg , antibiotic ointment each gm containing polymyxin b sulphate 5000 units zinc bacitracin 400 units neomycin sulphate 3400 units 5gm ointment , tab minocycline 100 mg , tab paraformaldehyde , tab antispasmodic containing mefenamic acid 250 mg and dicyclomine hcl 10mg , lactic acid bacillus sachet , hydrocortisone enema 10 percent w by w , tab bisacodyi 5mg , liquid paraffin in bottle of 100 ml , misoprostrol 25 mcg tab , tab isoxsuprine 10mg , estradiol valerate 2mg tab pack of 28 , sevelamer 400mg tab , ciprofloxacin hcl 0 point 3 percent tube of 5 gm , cyclopentolate hcl 1 percent opth soln bottle of 5 ml , cream luliconazole tube of 15 gm , dexamethasone sodium phosphate 1 percent and tobramycin 0 point 3 percent w by w oint tube of 3 point 5gm , beclomethasone dipropionate nasal spray 50 mcg per dose metered dose 150 units , chlorpromazine 25mg tab , tab amisulpride 200mg , dextrose 50 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , multi vit inj iv 2 10 ml with minimum constituents having thiamine b1 30mg per ml pyridoxine b6 30mg per ml and b12 cyanocobalamin 300 mcg per ml , capsacain gel tube of 20 gm , leflunomide tab 10 mg , nitrofurantoin 100 mg tab , eye drop brimonidine 0 point 2 percent plus brinzolamide 1 percent bottle of 5 ml , inj nitroglycerine 5 mg , tab semaglutide 3 mg , tab misoprostol 200mcg , inj tetanus toxoid purified absorbed rubber capped vial of 5 ml 10 doses , tab natural micronised progesterone 200mg , tab esomeprazole 40 mg plus levosulpride 75 mg , salmeterol 25 mcg plus fluticasone 250 mcg autohaler bid details/ 2 / 58

CTN :39986512

01 May, 2025 NA

Ahmedabad - Gujarat

Tender For supply of acenocoumarol 1 mg tab , phytomenadione vit k 1 mg per 0 point 5 ml inj , rivaroxaban 20 mg tab , fenofibrate 160 mg tab , pentoxifylline 400 mg tab , vitamin k 10 mg comma amp of 1 ml , bosentan 62 point 5 mg comma tab , tab perindopril 8mg , simvastatin 20mg tab , adenosine 3 mg slash ml comma 2 ml inj , amiodarone hcl 150 mg comma 3 ml inj , esmolol 100 mg comma 10 ml inj , prasugrel hcl 5 mg tab , nebivolol 5 mg tab , labetalol hcl 100 mg tab , tab propranolol tr 40 mg , vasopressin 20 units per ml inj comma 1ml ampoule , hydrochlorothiazide 25mg , ramipiril 5 mg plus hydrochlorothiazide 12 point 5 mg tab , povidine ioddine 2 percent gargles bott of 100 ml , paraformaldehyde tab , tab dutasteride 0 point 5 mg , mannitol 20 percent inj comma bottle of 350 ml , torsemide 20 mg tab , rifaximin 550 mg cap , tab levosulpiride 25 mg , tab entacavir 0point 5 mg , mebeverine hcl 135 mg tab , enema sodium phosphate 6 percent comma sodium acid phosphate 16 percent comma pack of 100 ml , glycerine suppositories child size 2g mould , isapgol slash ispaghula husk 3 point 5 gm , rebeprazole 20 mg plus domperidone 30 mg sustained release tab , loperamide 2mg tab , purified fsh 75 iu inj , carboprost tromethamine 250 mcg slash ml 1ml inj , clomiphene citrate 50 mg tab , doxylamine succinate 10mg usp plus pyridoxine hydrochloride 10 mg ip tab , oestrogen conjugated 0 point 625mg tab , human chorionic gonadotrophin 2000 iu inj , pyridostigmine 60 mg tab , succinylchloline chloride 50 mg slash ml comma 2 ml inj , cap tacrolimus 1 mg prolonged release , tab solifenacin 5 mg , calcium acetate 500 mg tab , tacrolimus 0 point 5mg cap , sevelamer 400 mg tab , tab l dash carnitine 500 mg , phenobarbitone syp 20 mg per 5 ml bott of 60 ml , natural surfactant 25 to 80mg per ml inj , human milk fortifier 2 gm sachet , bupropion hcl 150 mg sr tab , buspirone hcl 10 mg tab , agomelatine 25 mg tab , cap doxepin 25 mg , clozapine 100 mg tab , fluvoxamine 50 mg cap , desvenlafaxine 50 mg tab , etizolam 1 point 5 mg tab , olanzapine 5 mg tab , trazodone 50 mg tab , venlafaxine 75 mg tab , venlafaxine 37 poiint 5 mg tab , paliperidone palmitate 75 mg inj , quetiapine 25 mg tab , seroflo 250 syncyobreathe mdi salmetrol 25 mcg as salmetrol xinafoate ip fluticasone propionate ip 250 mcg , pirfenidone 200 mg tab , potassium chloride liquid 20 percent bott of 200 ml , micronised purified flavonoid fraction 1000 mg daflon 1000 , enteral feed powder comma protein 85 percent comma short chain peptides fat carbohydrate malto destri sachet of 126 gm to 200 gm protein powder , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , calcium 9 mg plus calcium gluconate 50 mg inj for iv use comma 10 ml injection , methyl prednisolone sodium acetate 80 mg inj , leflunomide 10 mg tab , inj benzathine penicillin i.p dot 600000 i dot u , artemether 80 mg comma lumefantrine 480 mg tablet , clindamycin 300 mg cap , emtricitabine 200 mg plus tenofovir 300 mg tab , nevirapine 200 mg tab , zidovudine 300 mg plus lamivudine 150 mg plus nevirapine 200 mg tab , oseltamivir 75 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5 mg tab , carvedilol 6 point 25 mg tab , calcium acetate 667 mg tab , melatonin 3 mg tab , prednisalone 10 mg tab , clindamycin 600 mg injection 150 mg per ml of 4 ml , piroxicam 40 mg comma 2 ml inj , indomethacin 25 mg tab slash cap , phenobarbitone 30 mg tab , grieseofulvin 500 mg tab , bromocriptine 2 point 5 mg tab , erythropoetin human recombinant comma 2000 iu slash ml point 1 ml inj , lignocaine hcl sol 2 bid details/ 2 / 155 percent for iv use comma 50 ml inj , enalapril maleate 10 mg tab , streptokinase 15 lacs iu inj , menotrophin 75u fsh plus 75ulh inj , thalidomide 100 mg , pioglitasone hcl 15 mg tab , imipramine 25 mg tab , tiptropium bromide 18 mcg dry powder cap , bromohexine syp 5 ml containing 4 mg of bromohexine hcl bott of 100 dash 150 ml , cough lozenges each containing noscapine 10 mg , leflunomide 20 mg tab , budesonide mdi 100u

State Government

CTN :39774838

19 Apr, 2025 NA

Thiruvananthapuram - Kerala

Tender For corrigendum : supply of multidishes tissue culture 4 wells - multidihestissueculture , silvertrate , acetone , highglucosedmem , collagenasetypeii , paraformaldehyde , glutaraldehyde , cd31 antibody , cd44antibodymousemonoclonal

CTN :39920471

25 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of grna synthesis , crispr oblique cas9 plasmid containing selectable marker for grna delivery , mouse hematopoietic stem cell isolation kit with magnet , mptp hydrochloride 100mg , rabbit anti mouse sca-1 antibody for icc , paraformaldehyde powder 500gm , poly-l-lysine solution 100 ml , dapi 10 mg , dpx mountant for histology 100 ml , cas9 protein 250ug

CTN :39920839

25 Apr, 2025 NA

Jaipur - Rajasthan

Tender For supply of tower bolts (ferrous metals) as per is 204 (q3) , pressure sensitive adhesive plasticized pvc tapes with nonthermosetting adhesive as per is 7809 (part 3 / section 1) (q3) , piano type non modular domestic fan regulator as per is 11037 (q3) , indoor end joint kit for xlpe cable 33 kv of size 300 sqmm , do fuse element 11kv 5 amp , straight through joint for xlpe cable 11 kv of size 240 sqmm , straight through joint for xlpe cable 33 kv of size 300 sqmm , fully automatic star delta starter in sheet enclose 15 hp motor rating ac 3 duty 415v 50hz 3 phase , cable junction box pvc for street light along with alum bus bar and provision of mcb installation , globe for harden light fitting 300mm , heatshrink cable end joint outdoor 11 kv 3 x 150sqmm xlpe cable , xlpe cable joint 11kv of size 120 185 sqmm 3 core ht cable straight through joint termination type , heatshrink outdoor end joint termination joint kit for 3 c x 300 sqmm 33kv xlpe cable , heatshrink cable end join outdoor 11 kv 3x 95sqmm xlpe cable , pvc back for chair varandah not less than 1 point 85 kgs , plywood commercial 8 feet x4 feet x 12 mm , plywood commercial 8 feet x4 feet x 6 mm , plywood commercial 8x4x19 mm , pvc seat for chair varanda with not less than 1 point 85 kgs , paint smoke grey og , looking mirror ladies size 1220x380x5mm thick make prima saintgobin modigurd , hydaulick system in best quality of chair revolving computer , pedestal bottom in best quality of chair revolving computer , twin wheel coasters in best quality of chair revolving computer , high precision telescopic channel made of mild steel 1point 25mm thick of 45kg capacity , supply only on load change over switch front operated switch disconector with extenderd shaft and ip 65 fp 400 amps 36 ka , supply only 3 phase automatic phase sequence corrector of 50 amp load capacity complete make abb , supply only 3 phase automatic phase sequence corrector of 20 amp load capacity complete make abb , xlpe cable alum conductor 3 core 300 sqmm 33 kv , 33 kv e 3 core 300sqmm standard aluminium conductor xlpe armoured cable , solar inverter 100kw , solar inverter 50kw , solar inverter 33kw , solar inverter 20kw , supply hi wall split air condition units in stone walls type split ac inverter model 5 star rating adheriing to specified bee 100 percent copper tubing and of capacity 2 point 0 tr , supply and fix voltage stabilizer for automatic operation single phase naturally air cooled indoor type and designed input vairiation between 170v to 250v , refrigerators 310ltr doble door , led kerb stone of size 500mm x 150mm x 200mm made out of 5 foundation rods ensuring complete protection against theft and having a led strip of length 470mm with 22 nos led duly plastic coated of any , gaseous type gravity feed chlorinator of capacity upto 2 kg hrs chemical grade panel board 6mm thick 2 x 4 feet pvc primary filter safety gauge teflon pipe 5 rm ubend secondary filter , new empty chlorine gas cylinder 100kgs capacity along with all accessories , chlorine cylinder emergency safety kit on operating cylinders consist of following accessories cylinder valve hood assembly 01 set cylider valve cap with silver coating valve 01 set , self contained open circuit breathing apparatus with oxygen cylinderfor duration of 30 minutes with audio alarm system light weight fiber glass back plate and two stage pressure reducing , upvc pipes sch 40 with fittings onwalls ceiling or laying in floors of size 25mm complete all as specified and directed by engineer in charge , gaseous type gravity feed chlorinator of capacity upto 2 kg hrs chemical grade panel board 6mm thick 2 feet x 4 feet mounted consist of flow meter , new empty chlorine gas cylinder 100kgs capacity alongwith all accessories , self contained open circuit breathing apparatus with oxygen cylinder for duration of 30 minutes with audio alarm system light weight fiber glass back plate and two stage pressure reducing sys , solar street light 40 watt made with high

Central Government/Public Sector

CTN :39933941

02 May, 2025 NA

Pune - Maharashtra

Tender For supply of coil element of 2.00 inch bsp threads .with rating - 6.0kw, 3 phase -340-400 volts suitable to work in corrosive environment in chemical tank of tri-sodium phosphate & calgon chemical liquid . [ warra nty period: 12 months after the date of delivery ]

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39758528

30 Jun, 2025 NA

Duliajan - Assam

Tender For expression of interest for item- crome casing pipes , chrome tubing pipes , drill pipes , heavy weight drill pipe , drill collars and lifting plug , drilling stabilizers , drilling/ workover handling tools --- elevators, tongs, , slips etc. , potassium formate , solid control equipment --- mud cleaner/ degasser/ , centrifuge/ linear motion shale shaker , sucker rod pump (srp) and its accessories , srp insert pump , ethyl mercaptan , low shear velocity fluids/polymers , emd chemical dosing pump, reciprocating pump , hsp 20/40, isp 20/40, isp 30/50 mesh , pig tracker/transmitter , pipeline locator , logging cables , tri cone roller drilling bits of various sizes , 11"od standard reverse circulating junk basket & 7.7/8" od reverse circulating junk basket , pdc drill bits of various sizes , fishing tool; 6.5/8 inches od junk sub for operation inside 8.1/2 inches hole , impression block for 4.5 inch od, 5.0 inch od, 9.625 inch od & 13.375 inch od casing , pneumatic spinner , 5.1/ 2" premium threaded casing (grade: n80 & grade p110) , cased hole logging units with tools and accessories along with installation, commissioning and training , wireline mast unit, including training and installation& commissioning , oil well explosives: (i) 2-1/8 inch tubing cutter along with detonator and hardware accessories , ii) 1-9/16 inch tubing puncher/ circulation charge & hardware accessories , oil well explosives: explosives for baker pressure setting tools: power charge, primary ignitor & secondary ignitor , procurement of oil well explosives used in exploration and production of hydrocarbon , 27.1/2" (698.50 mm) rotary table , 7.1/16" x 10 m double ram bop with accessories , 13.5/8" x 10 m single ram bop with accessories , 3.1/16" x 10 m flexible steel hoses for choke manifold , 3.1/8" x 5 m flexible steel hoses for choke manifold , 2.1/16" x 5m - ss flexible steel hose 3.1/16" x 10m - ss flexible steel hose , 3.1/8" x 5m flexible steel hoses , thermal wellheads for 7" and 9.5/8" casing completion with installation & commissioning , hose vibrator , rotary hose, drilling in assorted length , 2.34 mm (0.092") piano wireline (well measuring line) , static gel strength analyzer , electronic reservoir pressure and temperature measuring gauge. , automatic distillation apparatus , ft ir spectrophotometer , rheometer , 350 short ton drilling hook & elevator links (250 short ton, 350 short ton and 500 short ton) , digital acoustic liquid level measuring cum dynamometer equipment (echometer) , cross over, premium box x api eue & pup-joint, 2.7/8", premium in assorted length , geological thin section preparation unit comprising of cutting, vacuum impregnation, grinding and polishing equipment and consumables. , polarised microscope , pony drill collar , premium tubing , 37.1/2 rotary table , air gas permeameter , double block and bleed isolation plug , gas chromatograph , low to moderate temperature cement retarder , high temperature fluid loss control cement additive , xcd-polymer , xc-polymer (premium) , poly anionic cellulose-regular , poly anionic cellulose-super lo , junk sub 5.1/2 inch & 7 inch , 13.5/8-inch x 10000 psi annular bop , 13.5/8-inch x 10000 psi double ram bop. , ct reels , super fishing jar , drilling jar , overshots , slammer logging cables , 3 left hand kelly , multi element analyzer , high performance ep lube , mercury free pvt system , surface memory gauge , accessories of logging cable , downhole pressure temperature gauge , real time kinematic differential global positioning system , flow assurance software , seismic survey designing and modelling software , low to moderate temperature fluid loss control cement additive , high temperature cement retarder , cement friction reducer , isotope ratio mass spectrometer , fishing tool 6.75 od, axial vibrational, shock absorbing tool , 8 od, axial vibrational, shock absorbing tool , tubing stripper , nano-graphene based lubricant , tubing retrievab

Paraformaldehyde Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector