Phenol Crystal Tenders

Get complete information related to latest Phenol Crystal Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Phenol Crystal Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Phenol Crystal Tenders .

Filter

Loading....

Get Tender in Email

corporations/Associations/Others

CTN :40033980

24 Apr, 2025 4.71 Lacs

Delhi - Delhi

Tender For procurement of reagents and chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi - supply of reagents & chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi.ammonium chloride (500 gm), tri-ammonium citrate (500 gm), ammonium ferrous sulphate (500 gm), ammonium buffer solution (500 gm), boric acid ar (500 gm), bromocresol green soln. (125 ml), calcium chloride fused (500 gm), carbon tetrachioride(500 gm), di-potassium hydrogen ortho phosphate (500 gm), dithizone (5 gm), ethyl acetate (500 ml), ferric chloride (500 gm), ferrous sulphate crystalline (500 gm), haxane ar (500 ml), hydrochloric acid (500 ml), lead nitrate (500 gm), macconkey broth (500 gm), silver nitrate n/50 solution (500 ml), mercuric oxide(red/yellow) (100 gm), mercuric sulphate (250 gm), methyl red indicator soln.(125 ml), nitric acid (500 ml), methyl blue indicator alkaline (125 ml), paraffin wax 58-60 & 60-62 (500 gm), petroleum ether(bp 40-60c) (500 ml), phenol crystal(500 gm), phenolpthalen indicator solution (125 ml), 1.10 phenanthroline monohydrate (ferroin indicator) (5 gm), potassium dichromate ar(500 gm), potassium lodate(250 gm), potassium lodide(250 gm), potassium nitrate anhydrous ar(500 gm), potassium permanganate(500 gm), potassium sulphate (500 gm), silver sulphate(25 gm), sod.azide(100 gm), sodium chloride(500 gm), sodium meta bisulphite(500 gm), sodium nitrate(100 gm), sod.sulphite(500 gm), sod.thiosulphate(500 gm), sodium hydrogen phosphate(500 gm), stannous chloride(250 gm), sulphamic acid(500 gm), thymol blue indicator soln. (pack of 125 ml), edta n/50solution (500 ml)

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Phenol Crystal Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

corporations/Associations/Others

Central Government/Public Sector