Physical Protection System Tenders

Get complete information related to latest Physical Protection System Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Physical Protection System Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Physical Protection System Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :42270203

10 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For corrigendum : supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

CTN :42418847

09 Nov, 2025 114

Multi City - Karnataka

Tender For supply of lab chemicals and consumables to sub division hospital kollegala - dirui-probe cleaner 50 ml, dirui-bf-fdoi lyse 500 ml sdhk , dirui-bf-fdoi lyse 500 ml, dirui-bf-fbh lyse 500 ml, dirui-bf-5d diluent 20 lt, lyser cell 5ltr, sulfolyser 500ml sdhk , cell clean 50ml sdhk , flurocell wdf 42ml, dcl cell pack 20ltr sdhk , red tube (per tube), edta k3 tube (per tube) , hb metre, hb strips (50s per pack), urine strips (100s per pack), blood lancet (200s per pack), g r b s strips, widal kit sdhk , vdrl kit sdhk , glass sildes (50 sildes par pack), dengue kit sdhk , hbsag kit sdhk , pregnancy test kit sdhk , crp kit sdhk , aslo kit sdhk , ra kit sdhk , chromic catgut no 2-0(4241), chromic cat gut no2(4228), chromic catgut no (3-0), chromic cat gut no 1-0, chromic cat gut no 1(4259), polyglactin no 1-0(2346), polyglactin no 1(2347), polyglactin no2-0 (2436), polyglactin no 3-0(2437), nebulizer mask (pead), nebulizer mask (adult) sdhk , oxygen mask(paediatric), oxygen mask (adult) sdhk , d/s syringe2ml, d/s syringe 5ml, d/s triple layer mask, spinal needleno 27, spinal needle no 23 sdhk , plaster of paris 15x2.7, plaster of paris 10x2.5, bandage cloth 20 meter, formaldehyde solution 1 lit, cotton 500gm, i v cannula no 24, rubber sheet 1 meter, rexin sheet 1 meter, x-rayfilms 11x14 150films box, x-ray films 10x12 150films box, x -ray films 8x10 150films box, b p apparatus bladder, b p apparatus bulb, bdigital bp apparatus cuff, b p apparatous cuff, dust bin colour black colour 1kg, dust bin cover blue colour 1kg, dust bin cover yellow colour 1kg, dust bin cover red colour 1kg, dust bin cover green coluor 1kg, ultrsound gel 1kg, hydrogen peroxide 5ltr, infant feeding tube no 10 sdhk , infant feeding tube tube no 6, infant feeding tube no 5 sdhk , reyls tube no 16, ryles tube no 14 sdhk , hand wash 1lit, povidine ointment 125 gm , hydrogen peroxide 100ml sdhk , umablical card, glutaraldyhyde solution 5ltr, povidine solution 500 ml , surgical spirit 400ml, polypropylene mesh 6cmx11cm, surgical blade no 22 sdhk , surgical blade no 15 sdhk , surgical blade no 11 sdhk , spinal needle no 23 sdhk , infant feeding tube no 8 sdhk , infant feeding tube no 6 sdhk , suction tube no 10, suction tube no 8, suction tube no 6, urosac bag sdhk , infusion set (paediatric), et tube no 8 sdhk , et tube no 7.5, et tube no 6, et tube no 4.5, et tube no 4, et tube no 3.5, et tube no 3, et tube no 7, e t tube no 6.5, disposable gloves 7.5 sdhk , disposable gloves 7 sdhk , disposable gloves 6.5 sdhk , surgical gloves 7 5 pair, surgical gloves7 pair, surgical gloves 6 5 pair, ecg paper 210mmx20mtr, ecg paper 80mm x20mtr, follys catheter no17, follys catheter no 16, disposable syringe 10ml, i v cannula no 22, iv cannula no 18 sdhk , i v cannula no 20, infusion set (adult)

State Government

CTN :42402124

11 Nov, 2025 NA

Thiruvananthapuram - Kerala

Tender For supply of spares for syringe pumps and sle ventillators : : - main board for agilia sp syringe pump , force sensor for agilia sp syringe pump , battery for agilia sp syringe pump , display for agilia sp syringe pump , keypad for agilia sp syringe pump , flow sensor cable for sle 4000 to 5000 , flow sensor for sle 5000 hf ventilator , oxygen cell for sle 4000 to 5000 , power supply board for injectomat agilia syringe pump , disengagement lever switch for agilia for injectomat agilia syringe pump , force sensor with cable for injectomat agilia syringe pump , keypad cover kit , display board for injectomat agilia syringe pump , rechargable batteery pack 6 v for syringe pump injectomat agilia

State Government

CTN :42418499

13 Nov, 2025 2.00 Crore

Chandigarh - Chandigarh

Tender For supply of mechanical ventilator , disposable inbuilt dual heater wire and humidifier chamber ventilator circuit infant size , disposable inbuilt dual heater wire and humidifier chamber ventilator circuit pediatric size , niv mask non vented infant , niv mask non vented pediatric , niv mask vented infant , niv mask vented pediatric , disposable flow sensors if proximal flow sensor is required , heated humidifier , pediatric test lung , oxygen cell , reusable expiratory valve or cassettee , disposable expiratory bacterial or viral filter , disposable nebulizer kit , etco2 adaptor , high flow nasal cannula infant , high flow nasal cannula pediatric , cmc for first year , cmc for second year , cmc for third year , cmc for fourth year , cmc for fifth year , cmc for sixth year , cmc for seventh year , cmc for eight year

CTN :42452655

17 Nov, 2025 NA

Hyderabad - Telangana

Tender For supply of dglp 18 d d - oct catheter , ffr and dfr optical sensor bassed wire to assess arterial pressure , eto cartridge 40 gm compatible with sambion kill kinetics , tab cilostazole 100 mg , tab vericiguat 10 mg , tab vericiguat 5 mg , tab vericiguat 2 point 5 mg , primrose oil cap primosa , laryngoscope cell 1point 5 v diameter 13 mm and length 51 mm for type d , tab metalazone 5 mg , inj phenytoin sodium 100 mg , tab serratiopeptidase 5 mg , sodium valporate cr 300 mg tab , isopropanol and benzalkonium chloride skin antiseptic cutasept , tab divalproex sod er 1000mg , tab lithium carbonate cr 400 mg , cap gabapentin 100 mg , 26g cannula with injection port and luer lock , sodium valproate and valproic acid tab 500mg chrono cr , amitriptyline 10mg , inj mephentermine 30mg per ml 10ml , tube endo- tracheal nasal size 2 point0 without cuff , tube endo- tracheal nasal size 2 point 5 without cuff , disposable ventilator tubing compatible for hfo ventilator , double lumen pur umbilical catheter 4f , pigtail drainage catheter 6 and 8f with stiffening cannula and trocar , microvacutainer biochemistry , nasal cannula for oxygen administration for infant 1000 and 2500gm , 3 percent saline bott of 100ml , microvaccutainer haematology , sterile adhesive conforming soft nonwoven dressing absorbent pad 9 cmx25cm , sterile adhesive conforming soft nonwoven dressing absorbent pad 6 cmx8 cm , cast padding 10cmx 3m 10 percent variation in dimesnsion acceptable , cast padding 15cmx 3m 10 percent variation in dimesnsion acceptable , drill bit 2 point 7 mm , distal femoral supracondylar nail titanium 9mm and 11mm x 300- 360mm two matching , expert retrograde antegrade formal nail system with dia 9point 0 to 12point 0 mm , 3 point 5 mm lcp medial distal tibial locking plate titanium 4 and14 hole right left , disposable batteries compatible with linvatec surgical saw system , n acetyl cysteine 200 mg per ml 5 ml amopule , tab desmopressin 0 point 1 mg , inj tirofiban 5mg per 100 ml , inj fondaparinux 2 point 5 mg , inj diltiazem 5 mg per ml , amino acid preparation iv bott of 200 ml , intralipid 20 percent in bottle of 100 ml , t -piece in three sizes extension line , bone marrow aspiration needle , extension line with 3 way stopcock 10 cm , disposable feeding bags size 1 l or more , glycerin glycerol 500 ml , inj etomidate 2mg per ml 10 ml vial , cap sacchomyces boullardi 250 mg , tab ethambutol 1200 mg , inj milrinone 10mg per 10ml , lactic acid bacillus sachet , rivastigmine 5 sq cm patch delivering 4 point 6mg 24hr transdermal of 30 patches , tab escitalopram 5 mg , carboprost tropmethamine 250mcg per ml 1 ml , clotrimazole and clindamycin vaginal pessary 6 tab kit , inj betamethasone 4 mg 1 ml , pap smear , chlorhexadine gluconate solution equivalent to 4 percent isopropanol 10 percent ethoxylated , cap doxepin hcl 75 mg , cap memantine 5 mg , tab aripiprazole 15 mg , tab clozapine 25 mg , tab desvenlafaxine 50 mg , tab atomoxetine 10 mg , tab trazodone 50 mg , tab venlafaxine 37 point 5 mg , tab amisulpride 200 mg , tab quetiapine 25 mg , micro gen d 125 wet wipes , doxylamine succinate 10 mg usp and pyridoxine hydrochloride 10 mg ip tab doxinate , clindamycin 300 mg cap , bisacodyl 5 mg tab oct catheter, ffr/dfr optical sensor bassed wire to assess arterial pressure with frequency response of 0-25 hz, eto cartridge 40 gm compatible //bid details 2 / 63

Loading, Please wait...

Physical Protection System Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

State Government