GeM Registration
Login
Support:
7202092200
Sales:
9904990022
/
9687177333
Support:
7202092200
Sales:
9904990022
/
9687177333
Indian Tenders
Global Tenders
Tender Results
GeM Tenders
Register
Pay Now
GeM Registration
Login
Indian
Awarded
Global
Advance Search
Keyword
Word Search
search
Classic Tenders
Indian Tenders
Keyword Tenders
Physiological Monitor
Physiological Monitor Tenders
Get complete information related to latest
Physiological Monitor Tenders
. from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic
Physiological Monitor Tenders
, private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding
Physiological Monitor Tenders
.
Filter
By Cities
Loading....
By States
Loading....
By Agencies
Loading....
By Ownerships
Loading....
By Sectors
Loading....
Bid Submission Date Range
Only MM/dd/yyyy format allowed.
Only MM/dd/yyyy format allowed.
Tender Value
search
reset
All-Tenders (34)
Fresh-Tenders
Live-Tenders
Archive-Tenders
Search
Get Tender in Email
Central Government/Public Sector
CTN :42270203
10 Nov, 2025
16.98 Lacs
Bhimtal
-
Uttarakhand
Tender For corrigendum : supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42564669
14 Nov, 2025
40.0 Thousand
Amroha
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42581840
14 Nov, 2025
40.0 Thousand
Bareilly
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42581843
14 Nov, 2025
7.50 Lacs
Bareilly
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42581844
14 Nov, 2025
2.00 Lacs
Bareilly
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42581845
14 Nov, 2025
50.0 Thousand
Bareilly
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42581846
14 Nov, 2025
1.00 Lacs
Bareilly
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42377361
05 Nov, 2025
1.08 Lacs
Moradabad
-
Uttar Pradesh
Tender For bid to ras supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
State Government
CTN :42524866
10 Nov, 2025
1.32 Lacs
Moradabad
-
Uttar Pradesh
Tender For supply of forensic dna extraction kit (q3)
View Detail
Bid Tender
Download Document
Select Tender
CTN :42532614
15 Nov, 2025
35.00 Lacs
Mumbai
-
Maharashtra
Tender For supply of media chemicals and kits d d - xylose lysine deoxycholate agar , kovacs reagent , sodium chloride , simmons citrate agar , barritts reagent , methyl red indicator , grams stain , macconkey broth , selenite cystine medium , sheep blood agar plates , phenol red egg yolk agar , baired parker agar , nutrient agar , yeast glucose chloramphenicol agar , egg yolk tellurite emulsion , egg yolk emulsion , polymyxin b selective supplement , coagulase plasma w edta from rabbit , salmonella o antiserum , salmonella h antiserum poly , e.coli identification kit , salmonella identification kit , bacillus identification kit , satph identification kit , mktt novobiocin supplement vial , iodine powder , potassium iodide powder , disinfectant for floor cleaning , cleaning solution for glass petriplates , solution for fumigation , bacterial genomic dna purification kit , multi sample dna purification kit , molecular biology grade water , diluent for dna extraction , pcr kit , hplc water , formic acid , acetic acid , trifluoroacetic acid , sodium acetate anhydrous , ammonium formate , dmso gc headspace , ethyl acetate , diethyl ether , n hexane hplc , acetic acid ammonium salt , dichloromethane , zinc sulphate heptahydrate , ethanol , acetone for hplc , hydrochloric acid , sulphuric acid , ammonia solution , magnesium sulfate anhyd reagent , acetonitrile , nitric acid , methanol , iso propanol , magnesium sulphate sodium acetate anhyrdous centrifuge tubes , magnesium sulphate sodium acetate anhyrdous centrifuge tubes
View Detail
Bid Tender
Download Document
Select Tender
Loading, Please wait...
View More
×
Tender Document
Select State
Select City
369769
Get the Tenders in eMail
(Select any tender from the list)
×
Download Mobile App
×