Polyethylene Compound Tenders

Get complete information related to latest Polyethylene Compound Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Polyethylene Compound Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Polyethylene Compound Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :42270203

10 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For corrigendum : supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

CTN :42334710

07 Nov, 2025 NA

Udyogamandal - Kerala

Tender For corrigendum : tender for supply of laboratory chemcials : - calcium carbonate ar, hydrochloric acid. grade: ar/gr (pack.2.5 l, pottassium bromide ar, sodium molybdate ar, sulphuric acid.grade: ar/gr/er, cyanide standard solution, traceable to srm from nist., cyanide concentration: 1000mg/litre, salicylic acid lr, pyrogallol. grade: lr., ph buffer capsules (ph 4.0±0.05) pack containing, ph buffer capsules (ph 9.2±0.05) pack containing, ammonium acetate, grade: ar/gr, ammonium chloride, grade: ar/gr, ammonium fluoride ar/gr, ammonium molybdate-ar, boric acid, grade: ar/er/gr, ph paper, 2 to 10.5, 10 books in a packet, book containing 20 leaf each with colour chart in every book, ph buffer capsules (ph 7.0±0.05) pack containing, phenolphthalein indicator powder, grade lr, in containers of 50g, paraffin liquid.grade: ar/gr, phosphorous pentoxide.grade: ar/er/gr, sodium bicarbonate.grade: ar/gr, sodium hypochlorite containing 5-6% available chlorine, cadmium acetate dihydrate ar, minimum assay 9, ammonium hydroxide<(>,<)>, concentration: 25%, sp.gravity: 0.91, max limits of impurities: 0.01% non, volatile matter.chloride as, cl, :0.001% sulphate as so4: 0.002% arsenic as, as: 0.00002% iron as fe, :0.0001% lead as pb: 0.0001%, charcoal-activated, mono ammonium phosphate (map) 12:61:0, (100% water soluble), fertiliser grade conforming to fco.

State Government

CTN :42409964

06 Nov, 2025 NA

Srinagar - Jammu And Kashmir

Tender For supply of lithium bis trifluoromethanesulfonyl : - carbon disulide , tin ii ethylhexanoate , pyrogallol , glutaric acid , aluminium chloride , thiourea sd , dimethylamino pyridine , zinc sterate , zinc nitrate hexahydrate , o vanillin , bis pinacolato diboron , bisdiphenylphosphino ferrocene , benzenedimethanol , adamantanedicarboxylic acid , lithium bis trifluoromethanesulfonyl imi , diglycolic acid , zinc iodide , benzyl alcohal , nitrobenzoic acid , bromobutanoyl , ethyl acetate sa , dmso , diethyl ether , magnisium sulphate , sodium sulfate , thf , aq ammonium , isopropyl alcohol , potassium aceterate , eugenol , selenium powder , cesium carbonate , nitric acid , sulphuric acid , thionyl chloride , silicon oil , hydrogen peroxide , sodium chloride , sodium hydroxide , hexane , acetonitrile , ethanol , methanol , dichloromthane

Central Government/Public Sector

CTN :42251244

03 Nov, 2025 NA

Lucknow - Uttar Pradesh

Tender For supply of chemicals and consumables d d - l_methionine , phosphate buffer , edta , h2_o2 , borate buffer , l_phenylalanine , tri chloro acetic acid , hydrochloric acid , 2_ mercaptoethanol , 1m sodium buffer phosphate , pyrogallol , nitro_blue tetrazolium nbt chloride , pvp , riboflavin , guaiacol , triton x , tris hcl buffer , potato dextrose agar , nutrient agar , di sodium hydrogen phosphate , sodium di hydrogen phosphate , potassium hydroxide , sodium hypochlorite , lactophenol cotton blue , maxima sybr green_rox qpcr master mix 2x , revert aid first strand cdna synthesis kit , oat meal agar , streptomycin , permanent marker black , permanent marker red , micro tube racks 20 x 2ml , bluple nitrile examination gloves , non absorbent cotton wool , absorbent cotton wool , parafilm m125 , sterile disposable petri plates , disposable face masks , spatula 200 , wash bottle capacity 500ml , metaloop ch3 , thump press dispensing dropper , straight wire nichrome ) /bid number : gem/2025/b/6780307 * /dated: 11-10-2025 & & / bid document 1 / 32

Loading, Please wait...

Polyethylene Compound Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector