Latest polythelene tape Tenders | Government polythelene tape Tenders

CTN :39573832

22 Apr, 2025 NA

Dehradune - Uttarakhand

Tender For corrigendum : supply of enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) , gum spirit of turpentine oil as per is 533 (q3) , tyre nylon grip 28 x 1 and half inch , tube 28 x 1 and half inch , tyre nylon grip 26 x 1 and half inch , tube 26 x 1 and half inch , chain cover , screw mud guard long 1 inch , carrier clamp , chain bicycle , brake shoe complete , m g stay clip , chain wheel , seat clip , break u bolt , seat nut with bolt , stand spring , cotter pin , valve tube , ball 5 by 32 , ball 1 by 4 , pedal lh , pedal rh , spokes with nipple , crank plain , ball head race set of three , free wheel , reflector , cover saddle pvc , bb spindle with cup , chain adjuster , chain stay bolt , spindle hub rear , spindle hub front , hub cone , brake clip l and r , hub cup , handle grip , brake u rear , brake u front , solution tube , cutting plier , screw driver long 300 mm double side , open spanner 8x9 inch , open spanner 10x11 inch , ring spanner 12x13 inch , ring spanner 14x15 inch , pipe wrench 450mm , pedal spanner , parrot plier , free wheel die , hammer 300 gm , nipple key , scissor brass handle 300mm , rime bend wrench , tasla steel , compressor nozel , compressor pipe , paint brush 2 inch bid number/ & ( * ) : gem/2025/b/5964713 dated/ + : 05-03-2025 bid document/ 2 2 1 / 48

Central Government/Public Sector

CTN :39697545

25 Apr, 2025 NA

Solapur - Maharashtra

Tender For corrigendum : supply of chemicals - natural colour 10000 ul capacity la888 1 x 100no 1 x 100no , freezing bo x es cardboard dim 13.4 x 13.4 x 4.7cm 64 place freezing bo x 2 inch cg289 1 x 10no 1 x 10no , freeze tag white label size 25 x 13 mm 1000 labels pack roll form la938w 1 x 1000no 1 x 1000no , hiindicator ph paper la310 1pk 1pk , cryogenic permanent marker red dual point la697 1no 1no , cryogenic permanent marker black dual point la697a 1no 1no , hicap b18 blue coloured 18 mm od pw024 500no 1 no , hicap b38 blue coloured 38 mm od pw032 500no 1 no , triclogel in 5 lit can pack co155 1no 1 no , hi pette autopipette stand made with acrylic sheet 9 pipette holding capacity with tip bo x la632 1no 1 no , pikovskayas broth medium granulated gm1719 500g 500gm , aleksandrow broth m1997 500g 500gm , zinc solubilizing medium m2023 500g 500gm , 100bp dna ladder mbt049 200ln 200ln 4 x 200 ul , 2 x pcr taq mi x ture mbt061 100r 100r 2.5 ml , 50 x tae ml016 500ml 2 x 500 ml , syringe driven filters sf144 2 x 50no 2 x 50 no. , syringe driven filters sf143 2 x 50no 2 x 50 no. , petroleum ether 60 to 80 degree c hi ar as065 2.5l 2.5 liter , quantitative filter paper 0740 1250 100c , freeze tag la940w 1 x 1000no , l proline pct0317 25g 25 gm , polygalacturonic acid rm4779 5g 5 gm , orthophosphoric acid abt 88 percent hi ar as011 500ml 500 ml , hydrochloric acid abt 35 percent pure hi ar as004 2.5l 2.5 liter , ferrous ammonium sulphate he x ahydrate hi ar acs grm3887 500g 500 gm , potassium dihydrogen phosphate for hplc grm2951 250g 250 gm , diphenylamine hi ar acs grm520 250g 250 gm , paraffin liquid heavy grm6362 500ml 500 ml , paclobutrazol pct0828 25g 25 gm , buffer solution ph 4.0 plus or minus 0.02 ml061 500ml 500 ml , buffer solution ph 7.0 plus or minus 0.02 ml062 500ml 500 ml , buffer solution ph 9.2 plus or minus 0.02 ml063 500ml 500 ml , starch soluble hi ar acs grm3029 500g 500g , gluten hydrolysate maize rm6406 500g 500g , pectin grm396 500g 500g , guar gum powder grm1233 500g 500g , glycerol 85 percent as100 1l 1l , tween 80 lq520 x 25 x 10ml 25 x 10ml , gelatin type a mb169 500g 500gm , 2 4 6 tri2 pyridyl s triazine rm1487 1g 1 g , ferric chloride anhydrous tc583 5g 5 g , 2 2 diphenyl 1 picrylhydrazyl rm2798 1g 1 g , chitosan from shrimp shells grm9358 100g 100 g , sodium borohydride hi ar acs grm10345 100g 100 g , phenol reagent hi lr rm10822 100ml 100 ml , clear ph buffer solutions 480 ml bottleph 4.01 ecbu4bt 480 ml , clear ph buffer solutions 480 ml bottleph 7.00 ecbu7bt 480 ml , clear ph buffer solutions 480 ml bottleph 9.00 ecbu9bt 480 ml , hiindicator ph paper la335 1pk 1 pk , nutrient broth m002 500g 500 g , potato de x trose broth granulated gm403 500g 500 g , agar powder bacteriological grade grm026p 500g 500 g , autoclavable petri plates pw008 1 x 100no 1 x 100no , freeze tag la939w 1 x 1000no 1 x 1000no , parafilm d m250 la017 1no 1 no , s.s test tube racks la222 1no 1 no , hiclean liquid soap as023 5l 5 l , hidispo bag 14 pw038 250no 250 nos. , syringe driven filters pvdf hydrophilic membrane pore size 0.22 um 25 mm diameter with prefilter non sterile sf130 1 x 250no 1no. , sulfuric acid pure hi ar as016 500ml 500 ml , perchloric acid about 70 percent hi ar acs as013 500ml 500 ml , sodium hydro x ide pellets hi ar acs grm467 500g 500 g , methanol hi ar as059 2.5l 2.5 l , hydrochloric acid abt.35 percent pure hi ar as004 500ml 500 ml , citric acid anhydrous mb174 500g 500 g , amylase from malt grm638 500g 500 g , nutrient agar bid details/ 2 / 103 medium mm012 500g 500 g , potato de x trose agar mh096 500g 500 g , lactobacillus mrs agar mrs agar m641 100g 100 g , phytawrap pla002 1 x 10no 10 no , hi fle x iloop 2 pw012 5 x 100no 5 100no , mueller hinton agar m173 500g 500 g , potassium carbonate anhydrous hi ar grm731 500g 500 g , sodium benzoate hi ar grm1260 500g 500 g , sodium starch glycolate hi lr grm7519 500g 500 g , acetone hi ar as025 500ml 500ml , 0.1 percent peptone water lq172c 5 x 100ml 5 100ml , tric

State Government

CTN :39995735

25 Apr, 2025 NA

Bankura - West Bengal

Tender For supply delivery of safety items for chlorination system at udaypur ohr sites of saltora block under bankura mechanical division p.h.e dte. - supply and delivery at the site of the following safety items for chlorination unit make- as per approved unified vendor list vide official website of wbphed, canister type gas mask, spare canister for mask, self contained breathing apparatus with carrying harness, face mask, 1 set of valves, 2 nos 140 mm dia air cylinder of capacity 1200 lit (30 min duration), emergency kit for 100 kg chlorine cylinder, hand trolly for carrrying chlorine cylinder, ammonia torch with 1 no bottle of ammonia solution, weather sock, protective cloth, gum boot, gloves, goggles & safety helmet, aprons, wall mounted cabinet for lock, safety shower complete set, 380 mm exaust fan, add: 18% gst

CTN :40004585

03 May, 2025 NA

Ganjam - Odisha

Tender For supply of gic type i for luting 15 gm powder 10 gm liquid , gic type 9 for restoration , bur dia st fissure for airotor sf 11 pkt of 05 , bur dia st fissure for airotor sf 31 pkt of 05 , bur dia round for airotor br 31 pkt of 05 , bur dia round for airotor br 42 pkt of 05 , bur dia for airotor ex 21 pkt of 05 , bur dia tapper fissure for airotor tf 12 pkt of 05 , polishing bur for airotor pkt of 05 assorted size , mineral trioxide aggregate mta pkt of 1 gm , saliva ejector tips disposable pack of 100 , dental bleaching kit , light cured flowable composite kit , temporary filling material pkt of 40 gm , intermediate restorative material irm , articulating paper red and blue , rhodium coated mouth mirror with handle , endo access bur for airotor kit of 08 burs , k file no 15 40 31mm , k file no 45 80 31mm , k file no 06 21mm , k file no 06 25mm , k file no 08 21mm , k file no 08 25mm , k file no 10 21mm , k file no 10 25mm , k file no 15 21mm , k file no 15 25mm , spreader no 15 40 , plugger no 15 40 , universal hand protaper sx f3 21mm , universal hand protaper sx f3 25mm , endo rotary protaper gold sx f3 21 mm , endo rotary protaper gold sx f3 25 mm , endo rotary protaper gold sx f3 31 mm , endo rotary protaper gold sx 19 mm , gp points f1 , gp points f4 , gp points f5 , paper points f1 , edta 17 percent rc gel , calcium hydroxide paste with iodoform , calcium hydroxide paste for rct , navi tips blue code 29 gauze , inj lignocaine 2 percent with adr 1 80000 cart pkt of 50 , hand piece lubricant spray , gauze ribbon for dental , povidone iodine 10 percent solution bott of 100 ml , povidone iodine gargle 2 percent bott of 50ml , chlorhexidine mouth wash 0 point 2 percent bott of 100 ml , desensitizing tooth paste tube of 50 gm , inter dental tooth brush pkt of 05 , dental floss pick and floss , gum paint bott of 15ml , mouth ulcer gel benzocaine tube of 15 gm , sterillium , nitrile gloves small size pkt of 100 , nitrile gloves medium size pkt of 100 , pit and fissure sealent tube of 1 point 25gm , gluma desensitizer , hydrogen peroxide , disposable syringe 2 to 3 ml box of 100 , disposable syringe 5 ml box of 100 , composite finishing bur kit for airotor kit of 11 burs , composite finishing bur kit super snap kit , bmw bags disposable assorted colour , shoe cover for dispenser , patient bib plastic , n 95 mask , endodontic file system for rc re treatment d1 d3 21mm , path rotary files 21mm , glide path files proglider 2 percent 25mm , protaper next rotary files refill pack x1 x2 25 mm , rubber dam sheet medium pkt of 36 pieces size 6 inch x6 inch , disposable surgical gown , abrasive metal strips for shaping teeth pkt of 10 , normal saline , disposable tips for endo activator , gingival retraction cord , light cured gingival barrier syringe of 1point2ml , niti flexi k files no 15 40 21mm , niti flexi k files no 15 40 25mm , dental napkin , endo z bur bid details/ 2 / 60

Corporations And Associations And Others

CTN :39422929

21 Apr, 2025 51.44 Crore

Panchkula - Haryana

Tender For corrigendum : online tender for the rate contract for the supply of dental items to various hospitals of government of haryana for a period of two years for group c - cotton rolls ( small, pkt of 1000 pcs), disposable patient drape sheet 1*1mm, gum paint based on tannic acid, potassium iodide, zinc chloride, glycerine with thymol/ menthol /cetrimide, liquid 15 ml bottle, hybrid composite resin for anteriors (all shades), high strength, long lasting wear resitance, great handling without stick, 4 gm isi/ iso/ce/marked., rubber dam kit adult, box of 152*152 mm, medium rubber dam sheets, 152 mm template, 152 mm plastic dental dam frame, 6-11 clamps pack with clamp holder, rubber dam clamp forcep, rubber dam punch mdr/isi/iso/ce marked, glass ionomer cement- type-ix, high strenth for posterior teeth, chemical setting without shrinkage, strontium based, high flouride releasing, 12 to 15 gm powder and 5 to 10 gm liquid, mdr/isi/iso/ce marked, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel. shade :- pale yellow, shade :- pale yellow, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- yellow brown, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- dark grey, mdr/isi/iso/ce certified /usfda, disposable suction tips pkt of 100, mineral trioxide aggregate mdr/isi/ iso/ce/marked., silver alloy non gamma-2 lathe cut alloy, 30 gm vial mdr/isi/iso/ce marked, niti hand files (21 mm) size- 15-40, for curved canals, pkt. of six mdr/isi/iso/ ce marked, pit & fissure sealant ( 6 ml bottle) solution with high flouride releasing, low viscocity, high retention, rapid cure & low solubility. mdr/isi/iso/ce marked/usfda, preadjusted edgewise stainless steel bracket kit containing upper and lower 2nd premolar to 2nd premolar bondable brackets with upper triple and lower double weldable molar tubes and mbt 0.022 prescription, fiber- reinforced splinting material- bondable reinforced ribben fiber-approx 2mm width mdr/isi/ iso/ce/marked., niti rotary files 4% 21mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be specified at the time of order), addition silicone impression material (600 ml putty with 2 cartridges of 50 ml light body), air rotor spray isi/iso/ce marked, calcium hydroxide, paste system based and catalyst -radiopaque, 4 gm mdr/isi/iso/ce marked, acidulated phosphate fluoride gel 1.25%(apf), gic luting pkt. of 30-35gm powder, flowable composite 2-4 grams, x-ray processing solution(set of developer & fixer powder, manual, to make 13.5 ltr solution), root canal spreaders pkt. of 6 #15-40 21mm, dental chair covering sterilized cling foil rolls mdr/isi/ iso/ce/marked., mta pkt. of 1gm, tooth preparation kit (set of 14 burs), root canal k files 21mm (pkt. of 6) #15-40, dental amalgam capsules pkt. of 50 capsules, impression compound, gic restorative pkt. of 10-15 gm powder, bleaching kit, diamond burs- various shapes including round, tapered round, flat fissure, pear (size and shape of burs required will be specified at the time of order)- coarse / fine grit. pkt of 5, niti rotary files 4% 25mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be spe

CTN :39941144

21 Apr, 2025 9.64 Lacs

Sira - Karnataka

Tender For supply of hns and stationary to mch sira - hospital compound phenyl_mch sira, soap oil_mch sira, harpic_mch sira, cleaning acid_mch sira, bleaching powder_mch sira, linen detergent powder_mch sira, linen washing soap_mch sira, sabeena powder_mch sira, vim liquid_mch sira, hand battery (big)_mch sira, hand battery (small)_mch sira, hand battery shell (big)_mch sira, hand battery shell (small)_mch sira, plastic dust bin 10 liter_mch sira, plastic bucket 15 liter_mch sira, coconut broom_mch sira, monkey brand broom_mch sira, plastic mug 1 liter_mch sira, bath room cleaning brush_mch sira, plastic dust wiper_mch sira, wet mop with cotton_mch sira, dry mop with cotton_mch sira, both room fresheners (250ml)_mch sira, tube light frame chock and frame combo 20 watt_mch sira, tube light frame chock and frame combo 28 watt_mch sira, tube light 10 square_mch sira, c.f.l bulb 15 watt_mch sira, c.f.l bulb 25 watt_mch sira, room fresheners (240 ml)_mch sira, life boy hand wash liquid (250ml)_mch sira, life boy soap (125gm)_mch sira, dettol liquid (250ml) (250ml pack )_mch sira, sterilium & liquid hand wash_mch sira, bio medical waste bin 10 liter_mch sira, flask 500 ml (thermo flask)_mch sira, tissue paper(long size)_mch sira, door mat 3x6 (size)_mch sira, deck brush_mch sira, mosquito coil_mch sira, mosquito liquid_mch sira, rat mat_mch sira, glass cleaner wiper_mch sira, naphthalene tablet_mch sira, casting soda_mch sira, hypochlorite solution used in hospital_mch sira, superior quality long note book 100 page_mch sira, superior quality long note book 200 page_mch sira, superior quality long note book 300 page_mch sira, superior quality long note book 400 page_mch sira, stapler (small) (each box containing 10 pieces)_mch sira, stapler (big) (each box containing 10 pieces)_mch sira, stapler pin (small) (each box containing 10 pieces)_mch sira, stapler pin (big) (each box containing 10 pieces)_mch sira, file rapper_mch sira, xerox paper a4 (each rim containing 500 sheets) a4 size 21x29.7 cms plain copier paper gsm-80g/m2 thikness-105 micron equals /-5%_mch sira, xerox paper a3 (each rim containing 500 sheets) a3 gsm 120,size- 297 x 420mm (l x b)_mch sira, white paper_mch sira, tag (each box containing 20 pieces)_mch sira, fevistic_mch sira, single punch small (each box containing 10 pieces)_mch sira, single punch big(each box containing 10 pieces)_mch sira, hokar_mch sira, sketch pen (small) (each box containing 14 pieces)_mch sira, sketch pen (big) (each box containing 14 pieces)_mch sira, marker pen (each box containing 20 pieces)_mch sira, superior quality ink pad (big) 155x95 mm marker pen (each box containing 10 pieces)_mch sira, superior quality ink pad (small) 155x95 mm marker pen (each box containing 10 pieces)_mch sira, superior quality postal cover cloth line envelope size 12x10 inch_mch sira, postal cover a4 size_mch sira, parcel covera3 size_mch sira, gum bottle (small)_mch sira, gum bottle (big)_mch sira, pencil_mch sira, attendance register 200pages_mch sira, white transparent file cover_mch sira, file board_mch sira, id card with tag_mch sira, visitor pass (1/32 size) with subject matter printing_mch sira, abark bill books(1/8 size) with printing_mch sira, card board_mch sira, cd marker (each box containing 10 pieces)_mch sira, corban paper_mch sira, inch tape (each box containing 10 pieces)_mch sira, broun tape (each box containing 10 pieces)_mch sira, bind sheets colour (a4 size) _mch sira, khaki files_mch sira, office bill books(1/8 size long) with printing_mch sira, button file plastic_mch sira, with print content a4 (deliver certificate,lab report form, case sheets,diet sheets,abark forms etc._mch sira, with print content a3- format_mch sira, ink bottle (big) _mch sira, file flape size-76mmx76mm (3x3) 150 sheets_mch sira, calculator (display digit-10 display lines 1 type - businesswarranty - 24months net quantity (n)- 1 with new additional features special buttons for grand total (gt), mark up (mu) and correct (igrea

corporations/Associations/Others

CTN :39946328

30 Apr, 2025 13.08 Crore

Ahmedabad - Gujarat

Tender For supply of tread rubber precured gsrtc code no.41173 , p.t.r for tubeless gsrtc code no.41177 , p.t.r for tubeless mini tyre pattern gsrtc code no.41176 , bonding gum gsrtc code no.41154 , black vulcanizing solution gsrtc code no.41155

CTN :39794962

19 Apr, 2025 26.90 Lacs

Bhopal - Madhya Pradesh

Tender For supply of raw materials at tyre retreading unit at municipal corporation bhopal - supply of raw materials at tyre retreading unit at municipal corporation bhopal, tyre belt 65/65/450 d12, tyre belt 65/65 d13, tyre belt 185x"14, tyre belt 600x"16, tyre belt 700x"15, tyre belt 700x"16, tyre belt 750x"16, tyre belt 825x"16, tyre belt 900x"20, tyre belt 1000x"20, curing bag 65/65/450 d12, curing bag 65/65 d13, curing bag 185x"14, curing bag 600x"16, curing bag 700x"15, curing bag 700x"16, curing bag 750x"16, curing bag 825x"16, curing bag 900x"20, curing bag 1000x"20, bonding gum, solution drum, cutter blade machine, cutter hand buffing, pins

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39809503

14 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of plumbing items - 1.5 inches cpvc pipes , 1.5 inches cpvc in-trhread brass coupling , 1.5 inches cpvc elbow , 1.5 inches cpvc couplings , 1.5 inches cpvc ball value , 1.5 inches cpvc unions , 1.5 inches upvc t junction , 1.5 inches upvc unions , 1 inches cpvc ball value , 1 inches cpvc tank nipple , 1 inches cpvc in-thread brass , 2 inches x 1 inches cpvc reducer - 2 1e , ashirvad 118 gum solution , teflon tape , hexa blade , 1.5 inches g.i. clamps , 2.5 inches nails , 1.5 inches upvc out-thread couplings , 2 inches pipe , 2 inches elbow , 2 inches couppling , 2 inches mabt , 2 inches fabt , 2 inches union , solution

Polythelene Tape Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Corporations And Associations And Others

corporations/Associations/Others

Central Government/Public Sector

Central Government / Public Sector