Potassium Cyanide Tenders

Get complete information related to latest Potassium Cyanide Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Potassium Cyanide Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Potassium Cyanide Tenders .

Filter

Loading....

Get Tender in Email

State Government

CTN :40011758

24 Apr, 2025 NA

Ranchi - Jharkhand

Tender For rate contract for machine upkaran, medicine and others - laryngoscope classical tye, laryngoscope video assisted type - specification attached, abg machine advance version - specification attached, invasive bp mointoring, guided airway all no, cover for crush trolly, gully pot, stylate, ss tray with cover - big, ss tray with cover - small, vicryle - 0 - round body, vicryle - 1 -0 round body, vicryle - 2 - 0 round body, vicryle - 3 -0 round body, vicryle - 4 -0 round body, vicryle - 0 - cutting needle, vicryle - 1 -0 cutting needle, vicryle - 2 - 0 cutting needle, vicryle - 3 -0 cutting needle, vicryle - 4 -0 cutting needle, work station - specification attached, hma filter, inj dobutamine, inj. neotech, inj. vasopressin, inj. fentenyl, inj vecuronium, inj vancomycin, spo2 sensor double lock 6 pin, bp hose pipe, viscoappavise, dark goggles, tripan b/u, oint. ocupol, inj. pilocarpine, surgicell, bonewex, mouth gag, multi calcium, micro protein (regent), micro protein (control), aliquot tube, patient shifting roller - specification atteched, rectangle white plastic box with cover (big), rectangle white plastic box with cover (small), legging for drap the patient, wd-40 multi purpose spray (rust remover), plastic box round (big), plastic box round (small), sanitizer 500 ml litre, sanitizer 5 litre, inj vancomycin i gm, infantometer, glucometer (dr morpen), glucometer strip (bg-03 dr morpen) 50 strips, hammer, mersilk 3.0 cutting needle, botroclote nasal drop, monocryl suture 3.0 cutting body, syp. paracetamol 250mg, syp. calcium p, syp. levocetrizin hydrochlorde + montelukast 60ml, syp. colloidal lysine folic acid vitamin b12, drop hydroxyzin hydrochlorid 15ml, drop colloidal lysine folic acid vit. b12, diaper rash cream, nasal saline drop, sanitary pad - small, sanitary pad - medium, sanitary pad - big, human actrapid (soluble insulin inj. ) 40iu/ml, duracell battery aaa long lasting, gel diclofenac, inj buscopan (hyoscine butylbromide), inj urograffin 76, inj clesane (enoxaparin sodium), hydroxyethyl starch in isotonic sodium cholride intravenous infusion 6%, flexo-metallic armour endotracheal tube - all no, bolster pillow with pillowcase, foam prone position head cushion with mirror, foam gel positioners prone headrest, bougie adult size, lox 10% spray (lidocaine spary 10mg/puff) 50ml, lotion permethrin 5%, foot step (2 step), doctor & nurse dress with designation (paijama & kurta), fumigation machine, input power : 220 vac, 35 amp, 50hz, consistant particle size generation : 5-15 microns vmd, reach : 20-30 ft distance & 18-20 ft height, space treatment : up to 7000 cuft & even larger, nozzle assembly : non rotating vortex design ,non (fogging machine), roller bandage 6"x 3mtr, roller bandage 4"x 3mtr, betadin hand scrab - 500 ml, betadin hand scrab - 250 ml, measuring tape (inch tape), tray instrument/dressing with cover, measuring tape (inch tape), central line, height measurement scale ( stadio meter), ups 72 volt (3kva), knee hammer - pedia, knee hammer - adult, bed mattress (4 floded) - 4, inhalation isoflurance 500ml, ophthalmoscope, forehead therommeter, spacer, dack brush, fridge thermometer, notice borad pin, cella tape 1", cella tape 2", cella tape 3", brown cover paper, anatomical mask, nasopharyngeal airway, laryngoscope set - 3 blade, laryngoscope set - 4 blade, thyroxin 25mg, pink dress (shirt+paint) all size, duracell battery aaa long lasting, soft drop liquigel/justtears liquigel/refresh liquigel (carboxy methyl) celluose 1%, eye ont. ocupol, cardiac bed with mattress - specification attached, inj. actrapid, disnet solution 15l, disnet solution 1l, zebra guide wire size - 0.035, silicon catheter no - 12, silicon catheter no - 14, silicon catheter no - 16, silicon catheter no - 21, silicon catheter no - 22, liga clip size - all no, plastice stool, savlon - 1 litre, savlon - 500 ml, savlon - 250 ml, savlon - 100 ml, iv dextrose 500 ml, gram stain kit, inoculating loop, ggt reagent (erba xl - 640),

CTN :39920812

25 Apr, 2025 NA

Pune - Maharashtra

Tender For supply of phenol red , ph strip , turbidity transparency tube , hexamethylenetetramine 99 extra pure , hydrazine sulphate 99 ar acs , potassium chloride 99 extra pure , ethylenediamine tetraacetic acid disodium salt 99 ar acs , eriochrome black t aracs , ammonia solution 30 ar acs , ammonium acetate 98 molecular biology , silver nitrate 99 9 ar acs , potassium chromate 99 5 ar , griess reagent kit , n 1 naphthyl ethylene diamine dihydrochloride 98 ar acs , sulphanilic acid 99 ar acs , orthophosphoric acid 85 for hplc , sodium nitrite 98 ar acs , cadmium metal granular 99 9 ar , zinc metal granular 99 5 extra pure , potassium nitrite crystals 96 ar acs , o tolidine 98 ar , alizarine ar , sodium fluoride 99 ar , zirconium oxychloride octahydrate 99 ar , spadns ar , sodium arsenite 98 ar , hydrochloric acid 37 acipur , 1 10 phenanthroline hydrochloride monohydrate 99.5 ar , hydroxylamine hydrochloride 99 ar acs , acetic acid glacial 99 7 ar , ammonium acetate 99 for hplc , sodium acetate anhydrous 99 ar acs , ammonium ferrous sulphate hexahydrate 99 ar acs , arsenic trioxide 99 ar , mercuric bromide 99 ar acs , zinc dust 95 extra pure , sodium hydroxide pellets 98 ar , mercuric bromide strips , cupric chloride dihydrate 99 ar acs , dithizone 98 ar , chloroform 99 8 ar , sodium sulphite anhydrous 98 ar acs , lead acetate trihydrate 99 ar acs , chloramine t trihydrate 99 ar , pyridine 99 5 ar , barbituric acid 99 ar , potassium cyanide 97 ar , picric acid 99 8 ar , sodium carbonate anhydrous 99 5 extra , sodium dihydrogen orthophosphate dihydrate 99 ar , water sample analysis , macconkey broth double strength , macconkey agar , durhams tube

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Potassium Cyanide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector