Latest potassium format Tenders | Government potassium format Tenders

Central Government/Public Sector

CTN :40033396

08 May, 2025 NA

Bhopal - Madhya Pradesh

Tender For procurement of various consumables for routine diagnostics items for the dept of microbiology - rare disease medicine, ana igg profile (ena) (16x1), ana kit, anca kit, anti cardiolipin iga, anti cardiolipin igg, anti cardiolipin igm, anti ccp 2 elisa igg (euoroimmun), anti ds dna- ncx elisa igg (euoroimmun), anti mpo pr3/gbm (euoroimmun), anti gbm 96test, anti mpo 96test, aspergenius 2.0 species (lot-lpn2023057), aspergiillus species multiplex 28s rrna gene target kit, aspergillus ict igg igm (aspergillus fumigatus igm 96test), beta-d-glucan assay kit for dignosis of invasive fungal fungitel (25 tests per kit), brucella igm elisa kit (96 tests), chikungunia igm elisa kit (96 tests), cmv viral load quantitative real time pcr make altona (96tests), colum based viral rna extraction kit (qi aamp viral rna mini kit cat no. 52906, make: qiagen) (250tests), columbia agar + 5% sheep blood plates or trypticase soy agar + 5% sheep blood plates (50plates), crypto ps antigen (biosynx) 20tests, dengue igm elisa kit (96 tests), dna extraction kit, echinococcus igg antibody elisa kit (96tests), elisa for cmv igg kit, make drg international ivd, entamoeba histolytica igg elisa (96tests), fecal occult blood test ict kit (cancheck fobt) (10 tests), filariasis antigen detection immunochromatography kit, galactomannan aspergillus ag (96tests), genexpert c. difficile pcr assay kit (96 test per kit), hepatitis b hbsag elisa kit (96tests), hepatitis b viral load assay, rtpcr kit (96tests), hepatitis c total antibody elisa kit (96tests), hepatitis c viral load assay, rtpcr kit (96tests), histoplasma (oidx be sure) histoplasma capsulatum (20tests), igm antibody detection by elisa scrub typhus / scrub typhus igm elisa kit (96tests), leptospira antibody detection igm elisa kit (96tests), mini parasep sf faecal consentration tube (40tests), oxid be sure kit (200assayes), pneumocystis jirovecii qpcr kit 25rxn, quantitative real time for bk virus ivd kit (96tests), quantitative real time for epstine bar virus ivd kit ebv (96tests), quantitative real time for jc virus (96tests), rpr kit (250tests), sterile filtered ab serum, toxin a+b toxin detection c. difficiel kit vitassay (7715024) (10tests), toxoplasma gondi igg elisa kit (96tests), toxoplasma gondi igm elisa kit (96tests), toxoplasma igg avidity antibody elisa kit (96tests), widal slide test kit (250tests), widal tube test kit (4x50ml), cl.difficile toxin a&b rapid card test (10t), tab. everolimus 2.5mg, tab. everolimus 5mg, tab. everolimus 7.5mg, tab. everolimus 10mg, inj. ravulizumab 300mg/3ml, inj. ravulizumab 1100mg/11ml, inj. alirocumab 75mg/ml, inj. alirocumab 150mg/ml, inj. evolocumab 140mg/ml, inj. inclisiran 284mg/1.5ml, inj. burosumab 10mg/ml, inj. burosumab 20mg/ml, inj. burosumab 30mg/ml, inj. vutrisiran 25mg/0.5ml, inj. givosiran 189mg/ml, tab. voxelotor 500mg, tab. olaparib 150mg, tab. tucatinib 150mg, tab. ponatinib 15mg, tab. ibrutinib 140mg, inj. ustekinumab 130mg, inj. ustekinumab 90mg, inj. eculizumab 300mg, inj. brentuximab 50mg, isoleucine, leucine and valine free diet powder, lysine and tryptophan free diet powder, methionine free diet powder, leucine free diet powder, isoleucine, methionine, threonine and valine free diet powder, protein and amino acid free diet powder (with and without fat), phenylalanine free diet powder, non-essential amino acid free diet powder, phenylalanine and tyrosine free diet powder, galactose free formula, milk protein-based powder with medium-chain triglycerides (mct) for children and adults, protein hydrolysate formula base powder with iron for use with added carbohydrate, protein free formula, low carbohydrate, sucrose, fructose, sugar free formula, low protein substitutes glucose polymers individual amino acids, low protein. low fat & high carbohydrate formula, uncooked cornstarch with vitamins and minerals, human hemin for inj. 350mg hemin per vial, tab. carglumic acid 200mg, inj. hydroxocobalamin 30mg/ml, inj. lumasiran 94.5mg/0.5ml, inj

corporations/Associations/Others

CTN :39816385

24 Apr, 2025 NA

Delhi - Delhi

Tender For corrigendum : supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

State Government

CTN :39932244

25 Apr, 2025 NA

Rupnagar - Punjab

Tender For urchase of lab multipal items and chaff cutter - triss buffer (sigma t1378 7-9 ), citric acid monohydrate (merck cat.1.93011.0521), d.fructose (merck cat. 1.94905.0251d), glycerol anhydrous emperta (merck cat.1.07051.0521), lobolene (non spermcidal) ( ar grade), silvicide, formaldehyde solution (ar grade), ethanol (ar grade), methanol (ar grade), kmno4 (ar grade), savlon, filter paper no.1 (size 125 mm) (whatman), aluminium foil size 72 mtr., disposable hand gloves (medium size), tips disposable (microtips disposable) (2-200ul), tissue paper for lab use, flask 100 ml (conical flask- borosil), flask 150 ml (conical flask- borosil), glass slides (blue star), cover slips (blue star), chaff cutter

Central Government/Public Sector

CTN :39897922

23 Apr, 2025 NA

Narsapur - Andhra Pradesh

Tender For supply of potassium formate - ongc (q3)

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39758528

30 Jun, 2025 NA

Duliajan - Assam

Tender For expression of interest for item- crome casing pipes , chrome tubing pipes , drill pipes , heavy weight drill pipe , drill collars and lifting plug , drilling stabilizers , drilling/ workover handling tools --- elevators, tongs, , slips etc. , potassium formate , solid control equipment --- mud cleaner/ degasser/ , centrifuge/ linear motion shale shaker , sucker rod pump (srp) and its accessories , srp insert pump , ethyl mercaptan , low shear velocity fluids/polymers , emd chemical dosing pump, reciprocating pump , hsp 20/40, isp 20/40, isp 30/50 mesh , pig tracker/transmitter , pipeline locator , logging cables , tri cone roller drilling bits of various sizes , 11"od standard reverse circulating junk basket & 7.7/8" od reverse circulating junk basket , pdc drill bits of various sizes , fishing tool; 6.5/8 inches od junk sub for operation inside 8.1/2 inches hole , impression block for 4.5 inch od, 5.0 inch od, 9.625 inch od & 13.375 inch od casing , pneumatic spinner , 5.1/ 2" premium threaded casing (grade: n80 & grade p110) , cased hole logging units with tools and accessories along with installation, commissioning and training , wireline mast unit, including training and installation& commissioning , oil well explosives: (i) 2-1/8 inch tubing cutter along with detonator and hardware accessories , ii) 1-9/16 inch tubing puncher/ circulation charge & hardware accessories , oil well explosives: explosives for baker pressure setting tools: power charge, primary ignitor & secondary ignitor , procurement of oil well explosives used in exploration and production of hydrocarbon , 27.1/2" (698.50 mm) rotary table , 7.1/16" x 10 m double ram bop with accessories , 13.5/8" x 10 m single ram bop with accessories , 3.1/16" x 10 m flexible steel hoses for choke manifold , 3.1/8" x 5 m flexible steel hoses for choke manifold , 2.1/16" x 5m - ss flexible steel hose 3.1/16" x 10m - ss flexible steel hose , 3.1/8" x 5m flexible steel hoses , thermal wellheads for 7" and 9.5/8" casing completion with installation & commissioning , hose vibrator , rotary hose, drilling in assorted length , 2.34 mm (0.092") piano wireline (well measuring line) , static gel strength analyzer , electronic reservoir pressure and temperature measuring gauge. , automatic distillation apparatus , ft ir spectrophotometer , rheometer , 350 short ton drilling hook & elevator links (250 short ton, 350 short ton and 500 short ton) , digital acoustic liquid level measuring cum dynamometer equipment (echometer) , cross over, premium box x api eue & pup-joint, 2.7/8", premium in assorted length , geological thin section preparation unit comprising of cutting, vacuum impregnation, grinding and polishing equipment and consumables. , polarised microscope , pony drill collar , premium tubing , 37.1/2 rotary table , air gas permeameter , double block and bleed isolation plug , gas chromatograph , low to moderate temperature cement retarder , high temperature fluid loss control cement additive , xcd-polymer , xc-polymer (premium) , poly anionic cellulose-regular , poly anionic cellulose-super lo , junk sub 5.1/2 inch & 7 inch , 13.5/8-inch x 10000 psi annular bop , 13.5/8-inch x 10000 psi double ram bop. , ct reels , super fishing jar , drilling jar , overshots , slammer logging cables , 3 left hand kelly , multi element analyzer , high performance ep lube , mercury free pvt system , surface memory gauge , accessories of logging cable , downhole pressure temperature gauge , real time kinematic differential global positioning system , flow assurance software , seismic survey designing and modelling software , low to moderate temperature fluid loss control cement additive , high temperature cement retarder , cement friction reducer , isotope ratio mass spectrometer , fishing tool 6.75 od, axial vibrational, shock absorbing tool , 8 od, axial vibrational, shock absorbing tool , tubing stripper , nano-graphene based lubricant , tubing retrievab

Potassium Format Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others

State Government

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector