Latest potassium sulphate Tenders | Government potassium sulphate Tenders

corporations/Associations/Others

CTN :40033980

24 Apr, 2025 4.71 Lacs

Delhi - Delhi

Tender For procurement of reagents and chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi - supply of reagents & chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi.ammonium chloride (500 gm), tri-ammonium citrate (500 gm), ammonium ferrous sulphate (500 gm), ammonium buffer solution (500 gm), boric acid ar (500 gm), bromocresol green soln. (125 ml), calcium chloride fused (500 gm), carbon tetrachioride(500 gm), di-potassium hydrogen ortho phosphate (500 gm), dithizone (5 gm), ethyl acetate (500 ml), ferric chloride (500 gm), ferrous sulphate crystalline (500 gm), haxane ar (500 ml), hydrochloric acid (500 ml), lead nitrate (500 gm), macconkey broth (500 gm), silver nitrate n/50 solution (500 ml), mercuric oxide(red/yellow) (100 gm), mercuric sulphate (250 gm), methyl red indicator soln.(125 ml), nitric acid (500 ml), methyl blue indicator alkaline (125 ml), paraffin wax 58-60 & 60-62 (500 gm), petroleum ether(bp 40-60c) (500 ml), phenol crystal(500 gm), phenolpthalen indicator solution (125 ml), 1.10 phenanthroline monohydrate (ferroin indicator) (5 gm), potassium dichromate ar(500 gm), potassium lodate(250 gm), potassium lodide(250 gm), potassium nitrate anhydrous ar(500 gm), potassium permanganate(500 gm), potassium sulphate (500 gm), silver sulphate(25 gm), sod.azide(100 gm), sodium chloride(500 gm), sodium meta bisulphite(500 gm), sodium nitrate(100 gm), sod.sulphite(500 gm), sod.thiosulphate(500 gm), sodium hydrogen phosphate(500 gm), stannous chloride(250 gm), sulphamic acid(500 gm), thymol blue indicator soln. (pack of 125 ml), edta n/50solution (500 ml)

CTN :39870162

25 Apr, 2025 NA

Multi City - Telangana

Tender For corrigendum : procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liq

Central Government/Public Sector

CTN :40025038

07 May, 2025 4.20 Lacs

Sambalpur - Odisha

Tender For supply of lab equipment - charts , models , slide permanent , specimens , pictures posters charts , beaker , dropping bottle , forceps , funnel , micro viewers , microscope , petri dish , pipette , skeleton , test tube holders , test tube stand , watch glass , water bath , wash bottle , burette , capillary tube , thermometer , ammonium solution , chromatography paper , formaldehyde , glycerine , robert solution , micro cover slip , micro glass slides , millions reagent , needle , nitric acid , sucrose , test tube ordinary , ph paper , blade for section cutting , acetic acid , brushes , blow pipe , burette stand , test tube brush , cork borer , cork presser , crucible tongs , charcoal slab borer , crucible , deflagrating spoon , distilation apparatus , drying cones , funnel stand or filter stand , pestle and mortar , pinch cock , retort stand , round file , sand bath , spirit lamp , test tube stand , test tube holder , triangular stand , tripod stand , trough , wire gauze , triangular clay pipes , beehie sheft , burettle , china dish , conical flasks , dessicator , gas jar dises , flasks , gas jar or cylinder , glazed tile , measuring flasks , retort , thistle funnel , woulfes apparatus , watch glass , ammonium carbonate , ammonium chloride , ammonium sulfate , ammonium bromide , aluminum sulfate , iron sticks , potassium nitrite , ammonium oxalate , sodium thiosulphate , zinc sulfate , cobalt nitrate , sodium hydroxide , copper sulfate , potassium nitrate , oxalic acid , magnesium sulfate , magnesium chloride , ammonium phosphate , sodium chloride , potassium ferrocyanide k4fe cn 6 , ferrous sulfate , sodium bromide , ammonium ferrous sulfate , potassium dichromate , barium chloride , strontium nitrate , sodium sulphide , potassium chromate , lead acetate , sodium sulfate , potassium iodide , lead nitrate , cedric ammonium nitrate , 2,4 dnp , universal indicator , ammonia solution nh4oh , phenol , aniline , bromine water , acetaldehyde , fehling solution a b , acetone , carbon disulfide , phenolphthalein , nesslers reagent , ammoniumm olybdate , nickel carbonate , nickel sulfate , manganese chloride , calcium chloride , sodium bisulphate. , cobalt acetate , chloroform , magnesium ribbon , zinc granual , lead nitrate pb no3 2 , potassium iodide ki , lead metal pb , ethyl acetate , sodium metal , pottasium permanganet kmno4 , pottasium dichromate k2cr2o7 , hydro chloric acid hcl , sulphuric acid h2so4 , nitric acid hno3 , ethanol , test tube , test tube holder , dropper glass , filter paper , glass rod , sodium sulfite , picric acid , borax , cobalt glass , aluminum metal , spatula , laboratory thermometer , drawing board , friction apparatus complete set with weight box , parallelogram apparatus , helical spring apparatus with weights , resonance apparatus , spherometer , screw gauge , wooden scale , stopwatch , sonometer set , sprit level , vernier calliper , beakers , connecting wires , concave mirror , convex mirror , convex lens , concave lens , glass slab , pendulum bob , cork rubber , hanger weights , metalic bob , slinky spring , spring balance , copper calorimeter , wave pendulum , barometer tube , lactometer , proof plane , boyles law apparatus , fortnis barometer , metallic cylinders brass , metal sphere , youngs modulus apparatus , hydrometer , tunning fork , rubber pad , copper sulphate bid details/ 2 / 142

CTN :39983520

24 Apr, 2025 8.22 Lacs

Bhopal - Madhya Pradesh

Tender For supply of chemicals and equipments for water testing at 5 mgd water testing laboratory, zone no. 07. - murexide (ammonium purpurate) metal indicator acs, (make - siscochem/glaxo/merck)reag. ph eur (ammonium purpurate) (make - polychem/galaxy/merck) packing size 25g, ammonia buffer solution (make - siscochem/glaxo/merck) size 500ml, ammonium acetate (make - siscochem/glaxo/merck) packing size 500g, barium chloride dihydrate for analysis emsure acs,iso, reag. ph eur (make - polychem/galaxy/merck) packing size 500g, hydrochloric acid solution 1 l (make - siscochem/glaxo/merck), sulfuric acid 0.02n solution. (make - siscochem/glaxo/merck) packing size 500 ml, certificate membrane cartridges 0.45 pore size, 47 mm filter diameter, white fitter colour, 4 bands of 150 filter/pk ( (make - siscochem/glaxo/merck), beakers 100 ml (borosil/ jsil / rivera), beakers 250 ml (borosil/ jsil / rivera), beakers 500 ml (borosil/ jsil / rivera), beakers 1000 ml (borosil/ jsil / rivera), erlenmeyer (conical) flask 250 ml (borosil/ jsil / rivera), electronic pipette controller (borosil/ jsil / rivera), mohr pipettesclass b, white marking 10ml (borosil/ jsil / rivera), serological pipettesclass b, white marking 5.0 ml (borosil/ jsil / rivera), test tube 10 ml without rim (borosil/ jsil / rivera), sodium hydroxide pellets (make - siscochem/glaxo/merck) packing size 500g, silver nitrate (make - siscochem/glaxo/merck) packing size 100g, methyl orange indicator solution 250 ml (make - siscochem/glaxo/merck), universal indicator (ph) 100 ml (make - siscochem/glaxo/merck), erichrome black-t 25 gm (make - siscochem/glaxo/merck), edta solution n/50 (make - siscochem/glaxo/merck) packing size 500ml, 100 ntu (turbidity calibration standard- formazin ) packing size 500ml, glass droper bottle 125 ml (borosil/ jsil / rivera), m7 fc agar (himedia/ galaxo/ merck) packing size 500g, measuring cylinder (borosil/ jsil / rivera) packing size 50g, glass funnel borosil 75 mm (borosil/ jsil / rivera), sodium thiosulfate anhydrous (make - siscochem/glaxo/merck) packing size 250g, phenolphthalein indicator. (make - siscochem/glaxo/merck) packing size 125g, potassium chromate (make - siscochem/glaxo/merck) packing size 500g, nitrification inhibiter [nth 600] (make - siscochem/glaxo/merck) packing size per pack, sodium hydroxide tablets [nhp 600] (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (4-40 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 cod test cell tube (500-1000 mg/l) 16mm vile (make - siscochem/glaxo/merck), spectroquant prove300 nitrate cell test (dmp) range 0.5 25.0 mg (make - siscochem/glaxo/merck), spectroquant prove300 manganese test range 0.005-2.00 mg/l mn 250 tests (make - siscochem/glaxo/merck), spectroquant prove300 bod cell test range 0.5 3000 mg/l bod 50 tests (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 0.5 15 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 total nitrogen cell test range 10-150 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 fluoride test range 0.10 20.0 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 lead test range 0.010 5.00 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 iron cell test range 0.05 4.00 mg/l fe (make - siscochem/glaxo/merck), spectroquant prove300 sulfate cell test range 5 250 mg/l (make - siscochem/glaxo/merck), spectroquant prove300 sulfate test range 0.5-50.0 mg/l (make - siscochem/glaxo/merck), quartz crucibles without lid packing size 150ml, ice box 15 l with handle

Central Government/Public Sector

CTN :39921604

17 Apr, 2025 NA

East Godavari - Andhra Pradesh

Tender For supply of potassium sulphate (q3)

State Government

CTN :39200933

19 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39925067

25 Apr, 2025 2.00 Lacs

Dindigul - Tamil Nadu

Tender For supply of lab equipment - sulphuric acid, 1 n 500 ml , sodium bicarbonate 500g , phenolphthalein powder, 100 g , methyl orange powder, 25 g , wattman filter paper no.44, 100 pkt , ph indicators ph 4 10 cps, ph 7 10, cps ph 9.2 10 cps , saturated potassium chloride solution for double injection ph electrode, 480 ml , filter papers 1pkt 500 , calcium carbonate, 500 gm , edta ethyl diamine tetra-acetic acid,100 g , ammonia buffer solution ,500 ml , eriochrome black t indicator, 125 ml , hydrochloric acid, 4n 500 ml , 5 percentage potassium thiocyanate 500 ml , buffer solution for sulphate , barium chloride crystals,500 gm , sodium thiosulphate,500 gm , potassium dichromate, 500 gm , starch solution 2 per , sodium chloride solution,500 ml , silver nitrate,100 gm , potassium chromate 500 g , phosphate buffer solution,500 ml , magnesium sulphate 500 g , calcium chloride, 500 g , ferric chloride anhydrous 500g , sulphuric acid reagent,2.5l , hydrazine sulphate 100 g , magnesium chloride, 500 gm , ethanol, 500 ml , sodium sulphate anhydrous, 500 g , acetone 500 ml , sodium carbonate, 500 g , conc. nitric acid, 2.5 l , plate count agar, 500 gm , hexamethylenetetramine, 500 gm , spands, 5g , sodium fluoride, 500 gm , ferrous ammonium sulphate, 500 gm , ferroin indicator, 25 ml , mercury sulphate, 100 gm , sodium hydroxide,500gm , silver sulphate 25gm

CTN :39926758

26 Apr, 2025 NA

Kolkata - West Bengal

Tender For supply of o phthalaldehyde 0 point 5 or 0 point 55 w slace v with test strips , somatostatin inj 3mg , pancreatic enzyme supplement with a lipase content of 25000 units or more cap , n butyl cyanoacrylate 0 point 5ml inj , hydrocortisone enema 10 percentage w slace w , dicyclomine hcl 20mg inj , cremaffin white each 15 ml containing milk of magnesia 11 point 25 ml, liq paraffin 3 point 75 ml bottle of 170ml , enema sodium phosphate ml 6 percenatge sod acid phosphate 16 percenatge pack of 100ml , syp sucralfate 1000 mg slace 10ml plus oxetacaine 10 mg slace 10ml, bottle of 100 ml , polidocanol 3 percenatge slace 2ml inj , h pylori compliance kit each kit comprises of 2 cap amoxil 750 mg each, tab clarithromycin 500 mg each, tab pantoprazole 40 mg each , enema mesalazine 1gm slace 100ml pentasa , mesalamine suppository 1 gm , rapid urease enzyme kit , diclofenac sodium suppository 100 mg , tab sofosbuvir 400 mg plus tab velpatasvir 100 mg , coloprep sodium sulphate, potassium sulphate, magnesium sulphate oral solution 17 point 50 gm slace 3 point 13 gm slace 1 point 60 gm per bottle , cap budesonide cr 3 mg , inj ustekinumab 130 mg , inj ustekinumab 90 mg pfs , tab levosulpride 25mg , polyethylene glycol 3350, 119 gm pegred pdr , cholestyramine sachet 5mg slace sachet

Central Government And Public Sector

CTN :39896990

23 Apr, 2025 NA

Parganas - West Bengal

Tender For supply of 29 reagents for alcohol project - sodium tetraborate , trizma hydrochloride , tetraethyl orthosilicate , d plus glucuronolactone , sodium methoxide , perchloric acid seventy percent , hydrogen bromide solution in acetic acid , silver carbonate , barium hydroxide , sulfanilic acid , ammonium persulfate , aniline , acetyl chloride , sodium acetate anhydrous , 1 4 butanesultone , potassium tert butoxide , 3 pentadecylphenol , d glucuronic acid , sodium sulfide , ethyl alcohol pure , four methylumbelliferyl d glucuronide hydrate , four methylumbelliferyl phosphate chemical , ethyl beta d glucuronide solution , bovine serum albumin , human serum albumin , zinc sulphate heptahydrate , manganese ii chloride tetrahydrate , 3 mercaptopropyl triethoxysilane , cetyltrimethyl ammonium bromide ctab

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Potassium Sulphate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

corporations/Associations/Others

Central Government/Public Sector

Central Government/Public Sector

State Government

Central Government And Public Sector

Central Government/Public Sector